a Electrophoretic mobility shift and supershift assays with Caco-2 cell nuclear extract and –13915*G SNP region probe. Caco-2 cell nuclear extract protein (7 days post-confluent, 12.5 μg) was incubated with biotin-labeled –13915*G oligonucleotide probe (AGATAAGATAAGGTAGCCCCTGGC) alone (lane 2) or in the presence of 200-fold excess unlabeled –13915*G probe (lane 3), Oct-1 consensus (ATGTCGAATGCAAATCACTAGAACT) (lane 4), or non-specific (GTCACCCATTAGCACAGGCC) (lane 5, NS) oligonucleotides. Gel supershifts were performed with incubation in the presence of 2 μg Oct-1 specific antibody (Santa Cruz Biotech, lane 6) or control IgM (lane 7). Probe incubated in the absence of nuclear protein is shown in lane 1. EMSA reaction conditions and detection were performed as previously described (). Arrow indicates specific DNA/protein complex. b Electrophoretic mobility shift assays with Caco-2 cell nuclear extract and –13915*G, –13910*T and ancestral SNP region probes. EMSAs with 10 μg Caco-2 cell nuclear protein and biotin-labeled –13915*G, –13910*T (AGATAAGATAAGGTAGTCCCTGGC) (lane 4) or ancestral (AGATAAGATAATGTAGCCCCTGGC) (lane 5, AC) oligonucleotide probes. Gel supershifts were performed with incubation in the presence of Oct-1 specific antibody (lane 2) or control IgM (lane 1). Arrow indicates specific DNA/protein complex. c Luciferase activity of intestinal cells transfected with G/T-13915 SNP region lactase promoter–reporter constructs. Caco-2 cells were transfected with lactase promoter-luciferase reporter constructs in the presence of Oct-1 expression construct (; ) (black bars) or empty vector (white bars) and assayed for luciferase expression as previously described (). The p2kLac-13915 reporter constructs were generated by cloning a 218-bp fragment (–14017 to –13994) containing the –13915*G or –13915*T sequence upstream of the 2.0-kb rat lactase promoter cloned in pGL3 as previously described (). Transfection efficiencies were normalized to Renilla luciferase expression from a co-transfected pRL-CMV vector and expressed as relative luciferase activity (mean ± SD, n = 3)