Details of 2011 Reference Sequence Update
The S. cerevisiae strain S288C reference genome sequence was updated in its first major complete update since 1996. The new genome sequence (R64.1.1, 2011-02-03) was compared to the previous version (R63.1.1, 2010-01-05) and corrected accordingly. The sequences of all 16 nuclear chromosomes were updated, resulting in amino acid sequence changes to the 194 proteins listed below. Note that in addition to these, silent changes were made in 42 ORFs. For more information and a complete set of sequence changes, please see:
Engel SR, et al. (2013) The Reference Genome Sequence of
Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD
Paper
| PubMed
| Full-Text
ORF | Description of change |
---|---|
MDM10/YAL010C | Nucleotide change(s) in the coding region of MDM10/YAL010C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 272 is now Asparagine rather than Glutamine. New 781 ACAGGACGACCACTAACTTTGACATTATCTTGGAATCCATTATTCGGCCATATATCCTCC 840 ||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||| Old 781 ACAGGACGACCACTAACTTTGACATTATCTTGGCAACCATTATTCGGCCATATATCCTCC 840 |
DEP1/YAL013W | Two nucleotides were deleted near the 3' end of ORF DEP1/YAL013W, altering its coding sequence.The start and most of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 15 amino acids shorter.
New: 1201 CACCAGTGGGCCCAGTG--ACCGCCACACTGGACCCCATACCAC 1242 ||||||||||||||||| ||||||||||||||||||||||||| Old: 1201 CACCAGTGGGCCCAGTGTGACCGCCACACTGGACCCCATACCAC 1244 |
PSK1/YAL017W | Nucleotide change(s) in the coding region of PSK1/YAL017W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 73 is now Glutamic Acid rather than Glutamine. New 181 GTTTCAACCCCGAATAAAAAGGAAGGTGATGAGTTCGAGCAAAGTTTAAGAGATACATTT 240 |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| Old 181 GTTTCAACCCCGAATAAAAAGGAAGGTGATGAGTTCCAGCAAAGTTTAAGAGATACATTT 240 |
ATS1/YAL020C | Nucleotide change(s) in the coding region of ATS1/YAL020C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 305 is now Glycine rather than Alanine. New 901 GGCCCGCAAAAGGGCTCCCAGCCTGGACTGCAGCTCGTGGGCCAATACTCTGGAAAACCT 960 ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| Old 901 GGCCCGCAAAAGGCGTCCCAGCCTGGACTGCAGCTCGTGGGCCAATACTCTGGAAAACCT 960 |
MAK16/YAL025C | Nucleotide change(s) in the coding region of MAK16/YAL025C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 250 is now Glutamic Acid rather than Glutamine. New 721 TCTGACAGAGAAGCTTCCAGCGCCAGTGAAAGCGAAAGCGACAGTGAAAGCGAGAGCGAC 780 ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| Old 721 TCTGACAGAGAAGCTTCCAGCGCCAGTCAAAGCGAAAGCGACAGTGAAAGCGAGAGCGAC 780 |
DRS2/YAL026C | Nucleotide change(s) in the coding region of DRS2/YAL026C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 45-46 are now AN rather than GY, residue 450 is now Alanine rather than Arginine, residue 674 is now Proline rather than Glycine, residues 891-892 are now NT rather than KS, residues 953-954 are now GD rather than AS, and residue 987 is now Valine rather than Leucine. New 121 TCACATGCGAACGCGAATTATATACCACCAAGTCATGTACTTCCCGAAGAGACTATCGAC 180 ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| Old 121 TCACATGCGAACGGATATTATATACCACCAAGTCATGTACTTCCCGAAGAGACTATCGAC 180 New 1321 GAGAAAATTATCAACAGACAGATTATTGCATTGTTCACAGTTTTAATCGTGCTAATTTTA 1380 ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| Old 1321 GAGAAAATTATCAACAGACAGATTATTCGATTGTTCACAGTTTTAATCGTGCTAATTTTA 1380 New 1981 GGTGGTGCAGATTTAGGGTATAAGTTTATCATCCGTAAACCAAACTCTGTAACTGTTTTA 2040 ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| Old 1981 GGTGGTGCAGATTTAGGGTATAAGTTTATCATCCGTAAAGGAAACTCTGTAACTGTTTTA 2040 New 2641 AACGAGCATCAATTGTCAACACATGATATGAATACCTTAGCGCTCGTCATTGATGGGAAG 2700 |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| Old 2641 AACGAGCATCAATTGTCAACACATGATATGAAATCCTTAGCGCTCGTCATTGATGGGAAG 2700 New 2821 GTAAAAAGAAAGTCGTCTTCACTACTGCTAGCCATTGGCGA-TGGTGCCAACGATGTTAG 2879 |||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||| Old 2821 GTAAAAAGAAAGTCGTCTTCACTACTGCTAGCCATT-GCGAGTGGTGCCAACGATGTTAG 2879 New 2940 TCGTTCAGCTGATATAGCTGTTGGCCAATTTAAATTTTTaaaaaaaCTATTACTTGTCCA 2999 ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| Old 2940 TCGTTCAGCTGATATAGCTCTTGGCCAATTTAAATTTTTAAAAAAACTATTACTTGTCCA 2999 |
SPC72/YAL047C | Nucleotide change(s) in the coding region of SPC72/YAL047C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 302 is now Asparagine rather than Isoleucine. New 901 GAAAATTTGCACAAAGAATATGATCAATTTATAAATTCCATTAGATTGAAATTCGAGAAA 960 |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| Old 901 GAAATTTTGCACAAAGAATATGATCAATTTATAAATTCCATTAGATTGAAATTCGAGAAA 960 |
OAF1/YAL051W | Nucleotide change(s) in the coding region of OAF1/YAL051W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 70 is now Arginine rather than Tryptophan, residue 447 is now Glutamine rather than Proline, and residue 588 is now Lysine rather than Threonine. New 181 AGAATATTGTTTGTCTGCCAGGCTTGTAGGAAGTCAAAAACAAAGTGTGATAGAGAAAAA 240 ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| Old 181 AGAATATTGTTTGTCTGCCAGGCTTGTTGGAAGTCAAAAACAAAGTGTGATAGAGAAAAA 240 New 1321 GATTTTATTTTATTGAGTCAAAGATGTCTAGCATCGGAAAATTGGTGTGCATGCGCTAAT 1380 ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| Old 1321 GATTTTATTTTATTGAGTCCAAGATGTCTAGCATCGGAAAATTGGTGTGCATGCGCTAAT 1380 New 1741 CTAAGCGATATCAATAATCACAAACTTTTGAGAATTCATAAATTTACATTCAAGAGAGCC 1800 |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| Old 1741 CTAAGCGATATCAATAATCACACACTTTTGAGAATTCATAAATTTACATTCAAGAGAGCC 1800 |
FLC2/YAL053W | Nucleotide change(s) in the coding region of FLC2/YAL053W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 111 is now Cysteine rather than Serine, residue 312 is now Asparagine rather than Aspartic Acid, and residues 641-643 are now NDS rather than IDP. New 301 GATTTATGTTCCTTGGGCCAAGTATCGCTTTGCCCCCTAAGTGCTGGGCGTATTGATGTC 360 ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| Old 301 GATTTATGTTCCTTGGGCCAAGTATCGCTTTCCCCCCTAAGTGCTGGGCGTATTGATGTC 360 New 901 GATTACAATTTTGACACCATTTTAGACGATTCGAATCTGTACACCACTTCTGAGAAGGAT 960 ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| Old 901 GATTACAATTTTGACACCATTTTAGACGATTCGGATCTGTACACCACTTCTGAGAAGGAT 960 New 1921 AATGATTCTGAACTGTTTGAATTGAGAAAAGCTGTTATGGACACCAATGAAAATGAGGAA 1980 | |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| Old 1921 ATTGATCCTGAACTGTTTGAATTGAGAAAAGCTGTTATGGACACCAATGAAAATGAGGAA 1980 |
GPB2/YAL056W | Nucleotide change(s) in the coding region of GPB2/YAL056W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 661 is now Valine rather than Isoleucine, residue 802 is now Cysteine rather than Phenylalanine, and residues 814-815 are now ED rather than AA. New 1981 GTCAATCCAGGGAGAAAATCGTCATCTATTCCAATGACTGCGATAGGGAGACAGAGATTA 2040 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Old 1981 ATCAATCCAGGGAGAAAATCGTCATCTATTCCAATGACTGCGATAGGGAGACAGAGATTA 2040 New 2401 CAGTGTTGGGAAGAACATAAAATTACTCTGTCCAAGAAGGAAGACGATGAGGACAGACAA 2460 |||| ||||||||||||||||||||||||||||||||||| || |||||||||||||||| Old 2401 CAGTTTTGGGAAGAACATAAAATTACTCTGTCCAAGAAGGCAGCCGATGAGGACAGACAA 2460 |
YAL059C-A | Nucleotide change(s) in the coding region of YAL059C-A resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 36 is now Alanine rather than Serine. New 61 AAGGCCTTCACTAAACGATCCCTGTCCATGGATGAAATAGAGTTGGCCAGTTTGTCTTCC 120 ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| Old 61 AAGGCCTTCACTAAACGATCCCTGTCCATGGATGAAATAGAGTTGTCCAGTTTGTCTTCC 120 |
ECM1/YAL059W | Nucleotide change(s) in the coding region of ECM1/YAL059W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 102 is now Alanine rather than Aspartic Acid. New 301 CTGGCCAACTCTATTTCATCCATGGACAGGGATCGTTTAGTGAAGGCCTTGAATTTTACC 360 |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| Old 301 CTGGACAACTCTATTTCATCCATGGACAGGGATCGTTTAGTGAAGGCCTTGAATTTTACC 360 |
BDH1/YAL060W | Nucleotide change(s) in the coding region of BDH1/YAL060W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 322 is now Aspartic Acid rather than Alanine. New 961 GAAGACTTCGAAGAAGTTGTTCGTGCCATCCACAACGGAGACATCGCCATGGAAGATTGT 1020 |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| Old 961 GAAGCCTTCGAAGAAGTTGTTCGTGCCATCCACAACGGAGACATCGCCATGGAAGATTGT 1020 |
YAL064W | A single A nucleotide was inserted within ORF YAL064W, near its 5' end, moving the start codon out of frame with the rest of the protein. The C-terminus and majority of the reading frame remain the same, but the N-terminus has changed and the annotated protein is now 14 amino acids shorter.
New: 1 ATGCGAATATACTGCAACTTTTCGGCCTTTG 31 |||||| |||||||||||||||||||||||| Old: 1 ATGCGA-TATACTGCAACTTTTCGGCCTTTG 30 |
BUD14/YAR014C | Six separate single nucleotides were inserted within ORF BUD14/YAR014C, and three single nucleotide substitutions were also made, altering its coding sequence. The start, stop, and majority of the reading frame remain the same, but the annotated protein is now two amino acids longer and a small section of the protein sequence is now different.
New: 1830 ATTTGCCATTCCTCCACTAGACCCCAAGCTGGCTTGAATTTGCCCCTCTGTGTTTTCCAC 1771 ||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||| Old: 167043 ATTTGGCATTCCTCCACTAGACCCCAAGCTGGCTTGAATTTGCCC-TCTGTGTTTTCCAC 167101 New: 1770 GTTTGTTGTCTCTTCAATTTTCGATTTTGCATGAATATATTGTGAAATGTCCTTTATTGC 1711 ||||||||||||| |||||||||||||||||||| ||||| ||||| ||||||| ||||| Old: 167102 GTTTGTTGTCTCT-CAATTTTCGATTTTGCATGA-TATAT-GTGAA-TGTCCTT-ATTGC 167156 New: 1350 CACTACATCGCTCGTATCATCATCCTGGAATTTGCCAAAATTTAACTTCGCTTCAGTGTA 1291 |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| Old: 167517 CACTACATCGCTCGTATCATCATCCTGGAATTTGGCAAAATTTAACTTCGCTTCAGTGTA 167576 New: 1110 ATATCCATTCAGTGCAGGTGTCGGAATTATACTCTCTGCATCACTTTGATTCTTGTTACC 1051 ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| Old: 167757 ATATCCATTCAGTGCAGGTGTCGGAATTATACTCTCTGCATCACTCTGATTCTTGTTACC 167816 |
CDC15/YAR019C | Nucleotide change(s) in the coding region of CDC15/YAR019C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 316 is now Alanine rather than Arginine, residue 321 is now Alanine rather than Proline, and 900-902 are now KDV rather than NGC. New 901 TTTCAAGAAGAGAAACTAAATATATCACCCTCTAAATTCAGTCTTGCAGCGGCTCCCGCT 960 ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Old 901 TTTCAAGAAGAGAAACTAAATATATCACCCTCTAAATTCAGTCTTCGAGCGGCTCCCGCT 960 New 961 GCCTGGGCAGAAAACAATCAAGAACTAGATTTAATGCCCCCCACTGAAAGTCAATTGCTG 1020 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Old 961 CCCTGGGCAGAAAACAATCAAGAACTAGATTTAATGCCCCCCACTGAAAGTCAATTGCTG 1020 New 2641 TTCAAACTTCGTGCCATTTTAGTACAAATAACGGAGTTTTTAAACAACAACTGGAACAA- 2699 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Old 2641 TTCAAACTTCGTGCCATTTTAGTACAAATAACGGAGTTTTTAAACAACAACTGGAACAAC 2700 New 2700 GGATGTCCCAAAAAGGAATTCAAATCAAGTTgggggggACTCAGTTTTGATCTGTCAGCT 2759 |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| Old 2701 GGATGT-CCAAAAAGGAATTCAAATCAAGTTGGGGGGGACTCAGTTTTGATCTGTCAGCT 2759 |
YAR019W-A | A single C nucleotide was inserted very near the 3' end of ORF YAR019W-A, altering its coding sequence. The start and most of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 4 amino acids shorter.
New: 301 ACAGCAAAGTCCGCACAGAGCACTACAGTATAG 333 ||||||||||| ||||||||||||||||||||| Old: 301 ACAGCAAAGTC-GCACAGAGCACTACAGTATAG 332 |
YAR023C | Nucleotide change(s) in the coding region of YAR023C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 20 is now Phenylalanine rather than Valine, and residue 46 is now Phenylalanine rather than Isoleucine. New 1 ATGATCAATTTCCTCCTTTTTGTCTTGACGATTTTGGCGACTTTAACAAACATTTGGTTT 60 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || Old 1 ATGATCAATTTCCTCCTTTTTGTCTTGACGATTTTGGCGACTTTAACAAACATTTGGGTT 60 New 61 TCTGGTGTTCTCTCCCCTGCCATGGTGATCCGGATATGTTTAGGTGGCTCTATGGTAGTC 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Old 61 TCTGGTGTTCTCTCCCCTGCCATGGTGATCCGGATATGTTTAGGTGGCTCTATGGTAGTC 120 New 121 CTTCAGATATGGTCATTCAGTAGACCAATAAGTAATGAAACATTCCGTACAAAACTTCTA 180 ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| Old 121 CTTCAGATATGGTCAATCAGTAGACCAATAAGTAATGAAACATTCCGTACAAAACTTCTA 180 |
HIR1/YBL008W | Nucleotide change(s) in the coding region of HIR1/YBL008W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 260 is now Valine rather than Methionine. New 721 TCTCCCGATGGGCAACATATTGCAGTTCCGAACGCCACTAATGGGCCCGTAAGTTCTGTG 780 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || Old 721 TCTCCCGATGGGCAACATATTGCAGTTCCGAACGCCACTAATGGGCCCGTAAGTTCTATG 780 |
RRN6/YBL014C | Nucleotide change(s) in the coding region of RRN6/YBL014C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 39 is now Lysine rather than Asparagine. New 61 CAAGGCGCCAGTCTTTACTGTCCGCAAGAAAATTACACTACGAAGAAGCAAGAAAAGCCA 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| Old 61 CAAGGCGCCAGTCTTTACTGTCCGCAAGAAAATTACACTACGAAGAAGCAAGAAAACCCA 120 |
PTC3/YBL056W | Nucleotide change(s) in the coding region of PTC3/YBL056W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 369 is now Glycine rather than Aspartic Acid. New 1081 ATTGATGATCTTGATACCGAATTAGGCAGCAGTGCTACTCCCTCAAAGTTATCAGGTGAG 1140 ||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||| Old 1081 ATTGATGATCTTGATACCGAATTGGACAGCAGTGCTACTCCCTCAAAGTTATCAGGTGAG 1140 |
PTH2/YBL057C | One nucleotide was deleted within ORF PTH2/YBL057C, near its 5' end, altering its coding sequence. The stop and reading frame remain the same, but the start has been moved 18 nucleotides downstream and the annotated protein sequence is now six amino acids shorter.
New 113393 ATGGTGTAATTCGAAGAAACTGTCATCTTTTCCATTAAAAAG-ACGTTATCATGTTACTC 113451 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Old 113395 ATGGTGTAATTCGAAGAAACTGTCATCTTTTCCATTAAAAAGGACGTTATCATGTTACTC 113454 |
UBP13/YBL067C | Nucleotide change(s) in the coding region of UBP13/YBL067C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 180 is now Glutamine rather than Histidine. New 481 CTGTCCTCATTACGTGAAAATATATTGCAATTTCCaaaaaaaTCAAGAGAATCTGATCAA 540 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Old 481 CTGTCCTCATTACGTGAAAATATATTGCAATTTCCAAAAAAATCAAGAGAATCTGATCAC 540 |
PRS4/YBL068W | One nucleotide substitution and one trinucleotide deletion were made with the ORF PRS4/YBL068W, altering its coding sequence. The start, stop, and reading frame remain the same, but the annotated protein is now one amino acid shorter.
New 481 CCAAGTGTTTTAAATTATATTAGAAC---GAAAACAGATTTCGACAATGCTATTTTGGTG 537 |||||||||||||||||||||||| | ||||||||||||||||||||||||||||||| Old 481 CCAAGTGTTTTAAATTATATTAGAGCCCGGAAAACAGATTTCGACAATGCTATTTTGGTG 540 |
PET112/YBL080C | Nucleotide change(s) in the coding region of PET112/YBL080C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 415 is now Proline rather than Alanine. New 1201 AACAAGCTACAAATTCCATTGGCCAAAGCAAAAGAAATTTTGCCTCCTCCGGTTTTCGCC 1260 |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| Old 1201 AACAAGCTACAAATTCCATTGGCCAAAGCAAAAGAAATTTTGGCTCCTCCGGTTTTCGCC 1260 |
CDC27/YBL084C | Nucleotide change(s) in the coding region of CDC27/YBL084C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 430 is now Serine rather than Glutamine. New 1261 AGTAACTCAATACTAACGAGTGATTATTCAATTACGCTGCCTGAAATCATGTATAATTTC 1320 ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| Old 1261 AGTAACTCAATACTAACGAGTGATTATCAAATTACGCTGCCTGAAATCATGTATAATTTC 1320 |
TEL1/YBL088C | Nucleotide change(s) in the coding region of TEL1/YBL088C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 1412 is now Cysteine rather than Phenylalanine. New 4201 CGGGATCTCATCAAAATAAAAACTTGGAAATACTGCCTTGATGCAATATTCGGAAATATA 4260 |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| Old 4201 CGGGATCTCATCAAAATAAAAACTTGGAAATACTTCCTTGATGCAATATTCGGAAATATA 4260 |
MAP2/YBL091C | Nucleotide change(s) in the coding region of MAP2/YBL091C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 86 is now Aspartic Acid rather than Valine. New 241 CTGCAAAGAACCACGGATGAAGAATCACGTTATTTGAAAAGGGATCTGGAAAGGGCCGAA 300 |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| Old 241 CTGCAAAGAACCACGGTTGAAGAATCACGTTATTTGAAAAGGGATCTGGAAAGGGCCGAA 300 |
BRN1/YBL097W | Nucleotide change(s) in the coding region of BRN1/YBL097W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 517 is now Glycine rather than Alanine. New 1501 GACTTCCATTTTTCCACTGATAGAATAACAAGATTGTTCATTAAACCGGGGCAGAAAATG 1560 ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| Old 1501 GACTTCCATTTTTCCACTGATAGAATAACAAGATTGTTCATTAAACCGGCGCAGAAAATG 1560 |
ATP1/YBL099W | Nucleotide change(s) in the coding region of ATP1/YBL099W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 340 is now Serine rather than Proline. New 961 TTGTTGAGACGTCCTCCTGGTCGTGAAGCCTACCCTGGTGATGTCTTTTACTTGCATTCA 1020 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || Old 961 TTGTTGAGACGTCCTCCTGGTCGTGAAGCCTACCCTGGTGATGTCTTTTACTTGCATCCA 1020 |
PKC1/YBL105C | Nucleotide change(s) in the coding region of PKC1/YBL105C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 81 is now Cysteine rather than Phenylalanine, residue 621 is now Arginine rather than Lysine, and residue 789 is now Alanine rather than Proline. New 241 TGCAATTCGAAGGAATACGGGTTTCTTTCTACCAAATCGCCAAATGAACACATATTTTCT 300 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Old 241 TTCAATTCGAAGGAATACGGGTTTCTTTCTACCAAATCGCCAAATGAACACATATTTTCT 300 New 1861 AGAATTTCACTACAAACGCACGGGCGTGAGAAACTAAATAAATTTATCGATGAAAATGAG 1920 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Old 1861 AAAATTTCACTACAAACGCACGGGCGTGAGAAACTAAATAAATTTATCGATGAAAATGAG 1920 New 2341 TCCTTGGCTCCTACAAGTACTCATGCCTCCAGAACCACTGATCAACAATCTCCGCAGAAA 2400 |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| Old 2341 TCCTTGGCTCCTACAAGTACTCATCCCTCCAGAACCACTGATCAACAATCTCCGCAGAAA 2400 |
SRO77/YBL106C | Nucleotide change(s) in the coding region of SRO77/YBL106C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 130 is now Isoleucine rather than Phenylalanine, residue 135 is now Serine rather than Proline, residue 260 is now Serine rather than Alanine, residue 834 is now Glycine rather than Valine, residue 858 is now Threonine rather than Serine, and 943 is now Glutamic Acid rather than Lysine. New 361 GTTTTCTGTCCAAACAGCATCACTTGTATTGAGACTGATCCGTCCTTGGATTGGATGCTG 420 ||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||| Old 361 GTTTTCTGTCCAAACAGCATCACTTGTTTTGAGACTGATCCGCCCTTGGATTGGATGCTG 420 New 721 ATTCAGTCACTTTATCACCCAAATTCCTTACATATATTAACTGTCCATGAAGATAATTCC 780 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || Old 721 ATTCAGTCACTTTATCACCCAAATTCCTTACATATATTAACTGTCCATGAAGATAATGCC 780 New 2461 AGCGCTCAATACGTTGAAAATTCATCTATATTAGAAAATGGTGACATTGTCATTCGCACA 2520 |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| Old 2461 AGCGCTCAATACGTTGAAAATTCATCTATATTAGAAAATGTTGACATTGTCATTCGCACA 2520 New 2521 GGGAAATTCCAAGCCTCTTTGATTTCAGTACTTAATGAAAGTGCCACCGGAACGAATCAT 2580 |||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||| Old 2521 GGGAAATTCCAAGCTTCTTTGATTTCAGTACTTAATGAAAGTGCCACCGGTTCGAATCAT 2580 New 2821 GGTACGGAAGATCACAGGTATGCCAGACCTGTAAGAAGCTCTGGAAGAAGTAATGGATAT 2880 |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| Old 2821 GGTACGAAAGATCACAGGTATGCCAGACCTGTAAGAAGCTCTGGAAGAAGTAATGGATAT 2880 |
GPI18/YBR004C | Nucleotide change(s) in the coding region of GPI18/YBR004C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 187 is now Serine rather than Threonine. New 541 ATTTGGAGTCGTGAATGCTCCATTTCCGTGCCCGTATTGGGTCAATTCGATATTTCGTGG 600 |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| Old 541 ATTTGGAGTCGTGAATGCACCATTTCCGTGCCCGTATTGGGTCAATTCGATATTTCGTGG 600 |
DSF2/YBR007C | Nucleotide change(s) in the coding region of DSF2/YBR007C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 205 is now Serine rather than Arginine, and residue 327 is now Proline rather than Threonine. New 601 AGAAGCACAAATAGCCCTAATCCTTTCAACTTCGAGAAATATAGGATTGAAAATACTAGA 660 |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| Old 601 AGAAGCACAAATAGGCCTAATCCTTTCAACTTCGAGAAATATAGGATTGAAAATACTAGA 660 New 961 ACTAAGAGTGATACAACACCCATCAAACCATCTCCTAAACGGTCTAATTCCTCTACCTCG 1020 |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| Old 961 ACTAAGAGTGATACAACAACCATCAAACCATCTCCTAAACGGTCTAATTCCTCTACCTCG 1020 |
QDR3/YBR043C | Nucleotide change(s) in the coding region of QDR3/YBR043C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 37 is now Serine rather than Threonine. New 61 TCACTACCGAACAATCATGTTATGATGCACTGCGATGAAAGCAGCGGCAGCCCGCACAGC 120 ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| Old 61 TCACTACCGAACAATCATGTTATGATGCACTGCGATGAAAGCAGCGGCACGCCGCACAGC 120 |
TCM62/YBR044C | One nucleotide was deleted within ORF TCM62/YBR044C, very near its 3' end, altering its coding sequence. The start, stop, and majority of reading frame remain the same, but the C-terminus is different and the annotated protein sequence is now one amino acid shorter.
New 1681 ACATGTGTATACAAAAAGCCTGAACGGCACAAAGCCTAG 1719 |||||||||||| |||||||||||||||||||||||||| Old 1681 ACATGTGTATAC-AAAAGCCTGAACGGCACAAAGCCTAGATAA 1722 |
GIP1/YBR045C | A single nucleotide was inserted within ORF GIP1/YBR045C, altering its coding sequence. The start, stop, and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 66 amino acids longer.
New: 1740 GCTTAGTTGCTCTCCTCTCAGTCTATAATTTTCTGCTTCATTTCTCTGCCTTTTATACTC 1681 ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| Old: 328352 GCTTAGTTGCTCTCCTCTCAGTCTATAATTT-CTGCTTCATTTCTCTGCCTTTTATACTC 328410 |
BAP2/YBR068C | Nucleotide change(s) in the coding region of BAP2/YBR068C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 139 is now Valine rather than Glutamic Acid, and residue 203 is now Tryptophan rather than Glycine. New 361 CTACATTACGGTGGTCCTGCTGCGCTAATAATTGGTTACATCTTGGTTTCTTTCGTGACG 420 ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| Old 361 CTACATTACGGTGGTCCTGCTGCGCTAATAATTGGTTACATCTTGGTTTCTTTCGAGACG 420 New 601 CAATTTTGGAATGATAAAATAAATCCGGACATTTATATTCTTATTTTCTATGTTTTCTTA 660 |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| Old 601 CAATTTGGGAATGATAAAATAAATCCGGACATTTATATTCTTATTTTCTATGTTTTCTTA 660 |
RDH54/YBR073W | Nucleotide change(s) in the coding region of RDH54/YBR073W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 752 is now Alanine rather than Arginine. New 2221 AAATCGGGAGGTGTAGGATTGAATCTAGTCGGTGCTTCGCGACTTATTTTATTTGATAAT 2280 ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| Old 2221 AAATCGGGAGGTGTAGGATTGAATCTAGTCGGTCGTTCGCGACTTATTTTATTTGATAAT 2280 |
YBR074W | Nucleotide change(s) in the coding region of YBR074W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 832 is now Asparagine rather than Phenylalanine. New 2461 ATAGTTGCAGAGTTACTTTTGGAGGTGAAGGAGAACAGGGCTTGCACTTTAACTTTTGAA 2520 ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| Old 2461 ATAGTTGCAGAGTTACTTTTGGAGGTGAAGGAGTTCAGGGCTTGCACTTTAACTTTTGAA 2520 |
ECM8/YBR076W | A single G nucleotide was deleted near the 3' end, and a single A nucleotide was inserted near the 5' end of ORF ECM8/YBR076W, altering its coding sequence. The ORF was extended 49 amino acids at the N-terminus and shortened 34 amino acids at the C-terminus, resulting in a protein that is 15 amino acids larger. Although this protein is altered at both ends, the central portion of the protein remains the same.
New: 1 AAAGGAAAATATT-CAACGATAGCGAAAATTT 31 ||||||||||||| |||||||||||||||||| Old: 61 AAAGGAAAATATTGCAACGATAGCGAAAATTT 92 New: 1 ATAACAAAAAGCAATTGATTGTGTAC 26 ||||||||| |||||||||||||||| Old: 901 ATAACAAAA-GCAATTGATTGTGTAC 925 |
ECM33/YBR078W | One nucleotide was inserted within ORF ECM33/YBR078W, very near its 3' end, altering its coding sequence. The start, stop, and vast majority of reading frame remain the same, but the C-terminus is different and the annotated protein sequence is now 39 amino acids shorter.
New 1561 CTTGTTCCAGCCACTTCATTCATGGGTGTCGTTGCTGCTGTTGGCGTTGCCTTACTATAA 1620 ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| Old 1561 CTTGTTCCAGCCACTTCATTCATGGGTGTCGTTGCTGCTGTTGGCGTTG-CTTACTATAA 1619 |
NHP6B/YBR089C-A | Nucleotide change(s) in the coding region of NHP6B/YBR089C-A resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 30 is now Glycine rather than Arginine. New 61 AAGAAGGATCCTAACGCCCCTAAGAGGGGCTTGTCAGCTTATATGTTCTTTGCTAATGAA 120 ||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||| Old 61 AAGAAGGATCCTAACGCCCCTAAGAGGCGGTTGTCAGCTTATATGTTCTTTGCTAATGAA 120 |
YBR090C | Nucleotide change(s) in the coding region of YBR090C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 101 is now Alanine rather than Glycine. New 241 CAAAGGAACCAAAGAAGAGGACCACCAGGAGAAAGAAGGATCCTAACGCCCCTAAGAGGG 300 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Old 241 CAAAGGAACCAAAGAAGAGGACCACCAGGAGAAAGAAGGATCCTAACGCCCCTAAGAGGC 300 New 301 GCTTGTCAGCTTATATGTTCTTTGCTAATGAAAACAGAGACATTGTCCGTTCCGAGAATC 360 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Old 301 GGTTGTCAGCTTATATGTTCTTTGCTAATGAAAACAGAGACATTGTCCGTTCCGAGAATC 360 |
PBY1/YBR094W | Nucleotide change(s) in the coding region of PBY1/YBR094W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 450 is now Alanine rather than Arginine. New 1321 GAATCATTCACTATTGATTTAGATTATGCTGAATTTCTAGACGACGCATTAGATGAAAAT 1380 ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| Old 1321 GAATCATTCACTATTGATTTAGATTATCGTGAATTTCTAGACGACGCATTAGATGAAAAT 1380 |
VPS15/YBR097W | Nucleotide change(s) in the coding region of VPS15/YBR097W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 134 is now Alanine rather than Threonine, and residue 851 is now Arginine rather than Isoleucine. New 361 GACATTGAACTGAAATTCATTGCTTTCCAGTTGTTAAATGCATTAAAGGACATTCATAAT 420 ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| Old 361 GACATTGAACTGAAATTCATTGCTTTCCAGTTGTTAAATACATTAAAGGACATTCATAAT 420 New 2521 AACAAGGAAATTCCCTTAACTGCTGAAGACAGAAATTGGATTGATAAGTTCCACATTATT 2580 ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| Old 2521 AACAAGGAAATTCCCTTAACTGCTGAAGACATAAATTGGATTGATAAGTTCCACATTATT 2580 |
AIM3/YBR108W | Nucleotide change(s) in the coding region of AIM3/YBR108W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 515 is now Valine rather than Alanine. New 1501 AGTACCTCCAAGTCGTCCATTTTAGGACATTATGATGTAGATGTCAACATCATGCCACCT 1560 ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| Old 1501 AGTACCTCCAAGTCGTCCATTTTAGGACATTATGATGTAGATGCCAACATCATGCCACCT 1560 |
GRS1/YBR121C | Nucleotide change(s) in the coding region of GRS1/YBR121C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 563-564 are now TT rather than HH. New 1681 CCTGTTACTACTGAAGTCGCCAAAATCTTAAGAAAGTCTCAAATCCCATTTAAGATTGAT 1740 |||||| | ||||||||||||||||||||||||||||||||||||||||||||||||| Old 1681 CCTGTTCATCATGAAGTCGCCAAAATCTTAAGAAAGTCTCAAATCCCATTTAAGATTGAT 1740 |
YBR137W | Nucleotide change(s) in the coding region of YBR137W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 110 is now Glycine rather than Serine. New 301 TCAAGTTTCTATATGGGCTGCAAGAAAGGTGACAAAACACCGGAGGAAAAGTTTTTTGTG 360 ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| Old 301 TCAAGTTTCTATATGGGCTGCAAGAAAAGTGACAAAACACCGGAGGAAAAGTTTTTTGTG 360 |
YBR138C | Nucleotide change(s) in the coding region of YBR138C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 122 is now Leucine rather than Cysteine. New 361 CAATTGATAGGTGCCAAGCCTAAAATTCCATCCAAATTGTACCAATCTGTTTCCAAATTA 420 |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| Old 361 CAATGTATAGGTGCCAAGCCTAAAATTCCATCCAAATTGTACCAATCTGTTTCCAAATTA 420 |
YBR141C | Nucleotide change(s) in the coding region of YBR141C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 312 is now Proline rather than Serine. New 901 TTGTACTATTGTTTGTATCAATTGCAGGTAGTTCCACCGCAGCCGAGTAGCTTTTCCAAA 960 ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| Old 901 TTGTACTATTGTTTGTATCAATTGCAGGTAGTTTCACCGCAGCCGAGTAGCTTTTCCAAA 960 |
MCM7/YBR202W | Nucleotide change(s) in the coding region of MCM7/YBR202W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 552-558 is now GINTTLN rather than VINTNPG, and residue 574 is now Tyrosine rather than Isoleucine. New 1621 ATGGAACAACAAACAATTTCGATATCCAAGGCGGGTATCAATACAACTTTGAACGCCAGA 1680 |||||||||||||||||||||||||||||||||| ||||||||||| | | ||||||| Old 1621 ATGGAACAACAAACAATTTCGATATCCAAGGCGGTTATCAATACAAATCCGGGCGCCAGA 1680 New 1681 ACCTCAATCTTAGCGGCAGCAAATCCGTTGTATGGTAGATATAATCCTAGATTATCACCT 1740 ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| Old 1681 ACCTCAATCTTAGCGGCAGCAAATCCGTTGTATGGTAGAATTAATCCTAGATTATCACCT 1740 |
COS111/YBR203W | Nucleotide change(s) in the coding region of COS111/YBR203W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 727-731 are now TFRQH rather than SWRND, residue 917 is now Asparagine rather than Serine, and residue 921 is now Glutamic Acid rather than Glycine. New 2161 AAGTATTTTGTAATGAGGACGTTTCGCCAGCATTTGGATTATAAATCCATGGAAAACAAC 2220 ||||||||||||||||||| | || | ||||||||||||||||||||||||||||| Old 2161 AAGTATTTTGTAATGAGGAGCTGGCGAAACGATTTGGATTATAAATCCATGGAAAACAAC 2220 New 2701 TTAAAGGAGTTGAGGAGAGTTGATCTAAGGAGAAATGTTGGCGAAAATAACTACTATGCT 2760 |||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||| Old 2701 TTAAAGGAGTTGAGGAGAGTTGATCTAAGGAGAAATGTTGGCGAGAATAGCTACTATGCT 2760 New 2761 GAAAGCATCATAT 2773 | ||||||||||| Old 2761 GGAAGCATCATAT 2773 |
YBR204C | Nucleotide change(s) in the coding region of YBR204C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 63 is now Valine rather than Glutamic Acid. New 181 TTTAATGTACAACTATCGGATCGAAATTCAAGAATAAGGACGTGTCACAACTTGAGCGAT 240 ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| Old 181 TTTAATGAACAACTATCGGATCGAAATTCAAGAATAAGGACGTGTCACAACTTGAGCGAT 240 |
FTH1/YBR207W | Nucleotide change(s) in the coding region of FTH1/YBR207W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 18 is now Glutamic Acid rather than Lysine, residue 36 is now Glycine rather than Aspartic Acid, residue 228 is now Glutamic Acid rather than Glutamine, residues249-250 are now VF rather than YS, residue 334 is now Glycine rather than Glutamic Acid, residues 389-390 are now IC rather than KY, and residues 399-401 are now EKY rather than GKC. |
TSC10/YBR265W | Nucleotide change(s) in the coding region of TSC10/YBR265W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 255 is now Aspartic Acid rather than Glutamic Acid. New 721 CAAGCATGTGATATCATTGCCAAGTCGCTGGCCAGAGGTGATGATGACGTTTTTACAGAT 780 |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Old 721 CAAGCATGTGATATCATTGCCAAGTCGCTGGCCAGAGGTGATGAAGACGTTTTTACAGAT 780 |
SLM6/YBR266C | Nucleotide change(s) in the coding region of SLM6/YBR266C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 31 is now Serine rather than Threonine. New 61 TGTTCCAGTGGAATATCGACTCTGTTGCGTAGCTTTTCTTGCATTACTCTTTCCGCCATT 120 ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| Old 61 TGTTCCAGTGGAATATCGACTCTGTTGCGTACGTTTTCTTGCATTACTCTTTCCGCCATT 120 |
REI1/YBR267W | Nucleotide change(s) in the coding region of REI1/YBR267W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 152-153 are now KL rather than NV. New 421 GAGGAAGAAATGGCGGAAAGAGTAATGCAAGAAAAGCTACGCAACAGAGTCGATATTCCA 480 ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| Old 421 GAGGAAGAAATGGCGGAAAGAGTAATGCAAGAAAACGTACGCAACAGAGTCGATATTCCA 480 |
BIT2/YBR270C | Nucleotide change(s) in the coding region of BIT2/YBR270C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 152-153 are now SG rather than RA. New 421 AATTCAAAAGATAATATGAGAAATCGAAGCAGGAGCGGGTCAAAAAACTACGGCACTGTT 480 ||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||| Old 421 AATTCAAAAGATAATATGAGAAATCGAAGCAGGAGGGCGTCAAAAAACTACGGCACTGTT 480 |
RIF1/YBR275C | Nucleotide change(s) in the coding region of RIF1/YBR275C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 732 is now Alanine rather than Threonine. New 2161 GAATACGATAAAATCATGAAAGTTGTGTTCCAGGCTGTTGAAGTAGCCATTTCTAACGTT 2220 ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| Old 2161 GAATACGATAAAATCATGAAAGTTGTGTTCCAGACTGTTGAAGTAGCCATTTCTAACGTT 2220 |
YBR285W | Nucleotide change(s) in the coding region of YBR285W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 55 is now Aspartic Acid rather than Histidine. New 121 TTAGAAAGCCCCACTGACGATAGCATGGAGGCGGACATTTCAGATAGAGAAATGGCTACA 180 |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| Old 121 TTAGAAAGCCCCACTGACGATAGCATGGAGGCGGACATTTCACATAGAGAAATGGCTACA 180 |
APM3/YBR288C | Nucleotide change(s) in the coding region of APM3/YBR288C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 35-36 are now QS rather than RT. New 61 GGTGCAACAGCTCCCTCCTTCAAGCACCTGTGGACCCGCGTTCAGTCCACATGTCCTCAA 120 ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| Old 61 GGTGCAACAGCTCCCTCCTTCAAGCACCTGTGGACCCGCGTTCGTACCACATGTCCTCAA 120 |
SNF5/YBR289W | Nucleotide change(s) in the coding region of SNF5/YBR289W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 564 is now Aspartic Acid rather than Glutamic Acid. New 1681 TTTGAGTGGGACATCTCTAATAGTGATAACTGTCCAGAAGAGTTTGCAGAGTCCATGTGT 1740 ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| Old 1681 TTTGAGTGGGAGATCTCTAATAGTGATAACTGTCCAGAAGAGTTTGCAGAGTCCATGTGT 1740 |
PCA1/YBR295W | Nucleotide change(s) in the coding region of PCA1/YBR295W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 382 is now Histidine rather than Threonine. New 1141 GGACACTCTTCGAGTGAAATTTCAAGAATCGTATCAATGGAACCAATTGAAAATCATCTT 1200 ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| Old 1141 GGAACCTCTTCGAGTGAAATTTCAAGAATCGTATCAATGGAACCAATTGAAAATCATCTT 1200 |
YCL002C | A single T nucleotide was inserted within ORF YCL002C, near its 3' end, altering its coding sequence. The start and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 12 amino acids longer.
New: 661 ATACAATTTGTCACCTTATTGGTCATACTTTGTCAAGTTCAGTATGTTTACGTAG 715 ||||||||||||||| ||||||||||||||||||||||||||||||||||||||| Old: 779 ATACAATTTGTCACC-TATTGGTCATACTTTGTCAAGTTCAGTATGTTTACGTAG 832 |
PAT1/YCR077C | Nucleotide change(s) in the coding region of PAT1/YCR077C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 688 is now Aspartic Acid rather than Valine. New 2041 TTCCCTCCAAGGGAATATAACGACCACATCATGCGTTTACAAAATGACAAGTTTATGGAT 2100 |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| Old 2041 TTCCCTCCAAGGGAATATAACGTCCACATCATGCGTTTACAAAATGACAAGTTTATGGAT 2100 |
KIN82/YCR091W | Nucleotide change(s) in the coding region of KIN82/YCR091W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 341 is now Valine rather than Methionine. New 1021 GTGAGGGAACGCGATACCAACCAGATATTCGCCCTGAAAGTTTTGAATAAACATGAGATG 1080 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Old 1021 ATGAGGGAACGCGATACCAACCAGATATTCGCCCTGAAAGTTTTGAATAAACATGAGATG 1080 |
MPS1/YDL028C | Nucleotide change(s) in the coding region of MPS1/YDL028C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 211-213 are now TKR rather than RRE. New 601 GAGGATTCTCACCAAACAAACTTTAAAGAAACGAAGAGA-AATACGGATTATGATTCAAT 659 |||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||| Old 601 GAGGATTCTCACCAAACAAACTTTAAAGAA-CGAAGAGAGAATACGGATTATGATTCAAT 659 |
DBP10/YDL031W | Nucleotide change(s) in the coding region of DBP10/YDL031W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 733-741 are now SHSIEDEIL rather than HILSKMKFW, residue 746 is now Glycine rather than Valine, and residue 764 is now Aspartic Acid rather than Histidine. New 2161 AGGGAACTATTAGAAAAGGAAAGAATGGCTGGTCTTTCACATTCTATCGAAGATGAAATT 2220 |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| Old 2161 AGGGAACTATTAGAAAAGGAAAGAATGGCTGGTC-TTCACATTCTATCGAAGATGAAATT 2219 New 2221 TT-GAAAGGTGACGATGGTGAGACAGGTTACACCGTGTCAGAGGATGCCTTAAAAGAATT 2279 || |||||||||||||| |||||||||||||||||||||||||||||||||||||||||| Old 2220 TTGGAAAGGTGACGATGTTGAGACAGGTTACACCGTGTCAGAGGATGCCTTAAAAGAATT 2279 New 2280 TGAAGATGCGGACCAATTATTAGAAGCACAGgaaaacgaaaacaaaaagaaaaagaaaCC 2339 |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| Old 2280 TGAAGATGCGCACCAATTATTAGAAGCACAGGAAAACGAAAACAAAAAGAAAAAGAAACC 2339 |
POL3/YDL102W | Nucleotide change(s) in the coding region of POL3/YDL102W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 78-79 are now EL rather than DV. New 181 GCAAAGGATACAGATTTAATGGGTACGCAATTAGAGTCTACTTTTGAACAAGAGCTATCG 240 ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| Old 181 GCAAAGGATACAGATTTAATGGGTACGCAATTAGAGTCTACTTTTGAACAAGACGTATCG 240 |
UFD2/YDL190C | Nucleotide change(s) in the coding region of UFD2/YDL190C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 102 is now Leucine rather than Serine, and residue 677 is now Valine rather than Aspartic Acid. New 301 GCCTTACAAATAGAAAACTTTTGCATGAATGGTGCTTTCATCAATTATATCACTGGAATT 360 |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| Old 301 GCCTCACAAATAGAAAACTTTTGCATGAATGGTGCTTTCATCAATTATATCACTGGAATT 360 New 1981 CAATTGATCTGGCAGTCTCAAAACAATGCTGACTTTTTTGTGAGGTTCGTTGCTCGTATG 2040 ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| Old 1981 CAATTGATCTGGCAGTCTCAAAACAATGCTGACTTTTTTGTGAGGTTCGATGCTCGTATG 2040 |
SEC31/YDL195W | Nucleotide change(s) in the coding region of SEC31/YDL195W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 367 is now Threonine rather than Serine. New 1081 GAATCAAAAGAGAAGCCAACTGTTTTCCATTTACAAGCCCCAACTTGGTATGGGGAACCA 1140 |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| Old 1081 GAATCAAAAGAGAAGCCATCTGTTTTCCATTTACAAGCCCCAACTTGGTATGGGGAACCA 1140 |
AIM6/YDL237W | Nucleotide change(s) in the coding region of AIM6/YDL237W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 44 is now Asparagine rather than Aspartic Acid. New 121 AAAATATCGAATATTGATAACTTTGGGTTGACCGGTCAACATCTTTTAGAATTTTTCCAG 180 ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| Old 121 AAAATATCGGATATTGATAACTTTGGGTTGACCGGTCAACATCTTTTAGAATTTTTCCAG 180 |
ADY3/YDL239C | Nucleotide change(s) in the coding region of ADY3/YDL239C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 569 is now Glutamic Acid rather than Glycine. New 1681 caaaaactgaagagcgagttaaaagaaaaattaatactaagtgaaaaaattcagaaaaat 1740 ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| Old 1681 CAAAAACTGAAGAGCGAGTTAAAAGGAAAATTAATACTAAGTGAAAAAATTCAGAAAAAT 1740 |
LRG1/YDL240W | Nucleotide change(s) in the coding region of LRG1/YDL240W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 531 is now Glutamine rather than Histidine. New 1561 AACTCTTTACAGAGTACTATGCTAAAGGAACAAACTTACATTAGGACACTGAATGATATT 1620 |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| Old 1561 AACTCTTTACAGAGTACTATGCTAAAGGAACACACTTACATTAGGACACTGAATGATATT 1620 |
YDR215C | A single C nucleotide was inserted within ORF YDR215C, altering its coding sequence. The start and first half of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 10 amino acids longer.
New: 181 ACTAGGGCCCGCCCTTTCGGCAATCATTCTAGCATGTTCCGCATGTTCCTTGACGCCATG 240 ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| Old: 181 ACTAGGGCCCG-CCTTTCGGCAATCATTCTAGCATGTTCCGCATGTTCCTTGACGCCATG 239 |
ATP22/YDR350C | A single nucleotide was inserted within ORF ATP22/YDR350C, altering its coding sequence. The start, stop, and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 73 amino acids longer.
New: 1815 AAAGCCCCCGAAGAGTATCTTATTGTACCAGGAGCGTGCTCCTTTTTCGTCTCTCATTTT 1756 ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| Old: 1176355 AAAGCCCCCGAAGAGTATCTTATTGTACCAGGAGCGTGCTC-TTTTTCGTCTCTCATTTT 1176413 |
OPI7/YDR360W | A single C nucleotide was inserted within ORF OPI7/YDR360W, near its 3' end, altering its coding sequence. The start and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 16 amino acids longer.
New: 361 ACGCCTACGGGTAATAGCCGGCCTTTGA 388 ||| |||||||||||||||||||||||| Old: 361 ACG-CTACGGGTAATAGCCGGCCTTTGA 387 |
ERD1/YDR414C | Nucleotide change(s) in the coding region of ERD1/YDR414C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 168 is now Alanine rather than Glycine. New 481 TCTGACACGTTGACATCGTTTGCAAAACCATTGATAGACTTCACATTGTTTACCTCTCTA 540 |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| Old 481 TCTGACACGTTGACATCGTTTGGAAAACCATTGATAGACTTCACATTGTTTACCTCTCTA 540 |
UGO1/YDR470C | Nucleotide change(s) in the coding region of UGO1/YDR470C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 114 is now Glutamic Acid rather than Glycine. New 301 GCGGAATTGGTTAACATCCAGAAATGGCGAAAAATATTTGAACAACTGCTGGATATGTTT 360 |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| Old 301 GCGGAATTGGTTAACATCCAGAAATGGCGAAAAATATTTGGACAACTGCTGGATATGTTT 360 |
PSP1/YDR505C | Nucleotide change(s) in the coding region of PSP1/YDR505C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 532 is now Lysine rather than Glutamic Acid. New 2161 ATTTTAAACGCAGAATTCCAATTTGATAGAAAGAAATTAACGTTTTACTACGTTTGTGAG 2220 ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| Old 2161 ATTTTAAACGCAGAATTCCAATTTGATAGAAAGGAATTAACGTTTTACTACGTTTGTGAG 2220 |
RBA50/YDR527W | Nucleotide change(s) in the coding region of RBA50/YDR527W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 192-194 are now EEA rather than GEG. New 541 TTTgaagaagcaggaaaagaaaaagacgtggaagaagaagcaaaaaCTAATGATGACGTC 600 |||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||| Old 541 TTTGAAGAAGCAGGAAAAGAAAAAGACGTGGAAGGAGAAGGAAAAACTAATGATGACGTC 600 |
YDR541C | Nucleotide change(s) in the coding region of YDR541C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 341 is now Glutamine rather than Glutamic Acid. New 1021 CAGAACAGATTATGA 1035 |||||||||||||| Old 1021 GAGAACAGATTATGA 1035 |
YEN1/YER041W | Nucleotide change(s) in the coding region of YEN1/YER041W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 59 is now Alanine rather than Proline. New 121 GACGCATATGGATGGCTATTTGAGTGTGGATTTATCCAAAATATAGATATAAGCGCCAGA 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| Old 121 GACGCATATGGATGGCTATTTGAGTGTGGATTTATCCAAAATATAGATATAAGCCCCAGA 180 |
CEM1/YER061C | Nucleotide change(s) in the coding region of CEM1/YER061C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 367 is now Alanine rather than Arginine. New 1081 GGCCATCTTTTAGGTGCAGCTGGCGCCGTAGAAAGTATATTTACAATTTGTTCCTTGAAG 1140 |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| Old 1081 GGCCATCTTTTAGGTGCACGTGGCGCCGTAGAAAGTATATTTACAATTTGTTCCTTGAAG 1140 |
ALD5/YER073W | Nucleotide change(s) in the coding region of ALD5/YER073W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 411 is now Glutamic Acid rather than Glycine. New 1201 GTCAAGCCAACAGTGTTTGCTGATGTCAAAGAAGATATGAGAATTGTTAAGGAGGAAGTG 1260 ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| Old 1201 GTCAAGCCAACAGTGTTTGCTGATGTCAAAGGAGATATGAGAATTGTTAAGGAGGAAGTG 1260 |
PTP3/YER075C | Nucleotide change(s) in the coding region of PTP3/YER075C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 717 is now Alanine rather than Proline, and residue 738 is now Lysine rather than Q, and residue 857 is now Glutamine rather than Glutamic Acid. New 2101 gataatgataatgacaacaataataataacaataacaatagtaataTTGCTGTTACTGCT 2160 |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Old 2101 GATAATGATAATGACAACAATAATAATAACAATAACAATAGTAATATTCCTGTTACTGCT 2160 New 2161 GCTGCTTGtgatgatgatgatgatgatgatgatgaCGCAATTCTCATAAGAAAAATTCTG 2220 ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| Old 2161 GCTGCTTGTGATGATGATGATGATGATGATGATGACGCAATTCTCATAAGACAAATTCTG 2220 New 2521 GCAAAGTTATTCGATCCAATTTCATGGACAATTAATATTTTTAGAAAGCAACGAATATCC 2580 |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Old 2521 GCAAAGTTATTCGATCCAATTTCATGGACAATTAATATTTTTAGAAAGGAACGAATATCC 2580 |
RAD4/YER162C | Nucleotide change(s) in the coding region of RAD4/YER162C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 223 is now Valine rather than Glutamic Acid. New 661 GATAATGTGGGACTTTATATGAGAACCTGGAAAGAAATTGAAATGAGCGCCAATAACAAA 720 ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| Old 661 GATAATGAGGGACTTTATATGAGAACCTGGAAAGAAATTGAAATGAGCGCCAATAACAAA 720 |
STE2/YFL026W | Nucleotide change(s) in the coding region of STE2/YFL026W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 269 is now Lysine rather than Glutamic Acid. New 781 ATATTCATCCTCGCATACAGTTTGAAACCAAACCAGGGAACAGATGTCTTGACTACTGTT 840 |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| Old 781 ATATTCATCCTCGCATACAGTTTGGAACCAAACCAGGGAACAGATGTCTTGACTACTGTT 840 |
YFL034W | Nucleotide change(s) in the coding region of YFL034W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 323 is now Lysine rather than Asparagine. New 961 CACAAGAAACTAGCACATAGATTACAGTTTACCCAGAAGGATATGGCTGCTTGGAAAACT 1020 |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| Old 961 CACAAGAACCTAGCACATAGATTACAGTTTACCCAGAAGGATATGGCTGCTTGGAAAACT 1020 |
FAB1/YFR019W | Nucleotide change(s) in the coding region of FAB1/YFR019W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 2275 is now Arginine rather than Tryptophan. New 6781 GCAATGGAGAGGTATATTTTGATGGTTCCTGATCCGTGGTATAGGGAAGGAAATTAA 6837 |||||||||||||||||||||||||||||||||||||||||| |||||||||||||| Old 6781 GCAATGGAGAGGTATATTTTGATGGTTCCTGATCCGTGGTATTGGGAAGGAAATTAA 6837 |
SAP155/YFR040W | Nucleotide change(s) in the coding region of SAP155/YFR040W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 663 is now Asparagine rather than Threonine. New 1981 AAGCAAAACATAAAACTTAGGACCGACCCCACGGTCGGGGACCTATTCAAAATCAAACTA 2040 ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| Old 1981 AAGCAAACCATAAAACTTAGGACCGACCCCACGGTCGGGGACCTATTCAAAATCAAACTA 2040 |
YGL041C | A single nucleotide was deleted near the middle of ORF YGL041C, shifting its reading frame and altering its coding sequence. The start remains the same, but the C-terminus has changed and the annotated protein is truncated by one-third of its length (from 104 amino acids down to 67 amino acids).
New: 121 TCTAGATTAACCAATTTTTTTTCGATCATGATATTGCTAACCTTTTCTAACTTTTCC-AGAACATTAGGCCTCGAATTTATTTGA 204 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| Old: 121 TCTAGATTAACCAATTTTTTTTCGATCATGATATTGCTAACCTTTTCTAACTTTTCCCAGAACATTAGGCCTCGAATTTATTTGA 205 |
YGL041W-A | A single G nucleotide was deleted within ORF YGL041W-A, altering its coding sequence. The C-terminus and majority of the reading frame remain the same, but the N-terminus has changed and the annotated protein is now 72 amino acids longer.
New: 31 TTGCTAACCTTTTCTAACTTTTCC-AGAACAT 1 |||||||||||||||||||||||| ||||||| Old: 154 TTGCTAACCTTTTCTAACTTTTCCCAGAACAT 185 |
SDS23/YGL056C | Nucleotide change(s) in the coding region of SDS23/YGL056C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 180 is now Glycine rather than Alanine. New 481 AAGGTGAGCAACGACAAGATAACCTCAGACTGCCAGAATGGTAAGTCCGTGCCCGTGGGC 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Old 481 AAGGTGAGCAACGACAAGATAACCTCAGACTGCCAGAATGGTAAGTCCGTGCCCGTGGCG 540 |
PKP2/YGL059W | Nucleotide change(s) in the coding region of PKP2/YGL059W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 224-225 are now SI rather than VY. New 661 GAACACGTCAGTAT-CACAGCCAACTACACTAGTGGTAAGGAGGAAAATACCTTGGTATT 719 ||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||| Old 661 GAACACGTC-GTATACACAGCCAACTACACTAGTGGTAAGGAGGAAAATACCTTGGTATT 719 |
PUS2/YGL063W | Nucleotide change(s) in the coding region of PUS2/YGL063W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 136 is now Cysteine rather than Serine. New 361 ATTGGTCCACCCCGGAGTTCTCTTTTGCATCGAAACGTGGGGGGATGCTACCGCGAAGAC 420 |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| Old 361 ATTGGTCCACCCCGGAGTTCTCTTTTGCATCGAAACGTGGGGGGATCGTACCGCGAAGAC 420 |
YGL109W | Nucleotide change(s) in the coding region of YGL109W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 26 is now Glutamine rather than Lysine. New 61 AGAATGGAAGGCCAACaaaaaaaTTCTTGTACAATTGCATATATTGATTCATTACAATAT 120 ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| Old 61 AGAATGGAAGGCCAAAAAAAAAATTCTTGTACAATTGCATATATTGATTCATTACAATAT 120 |
MON1/YGL124C | Nucleotide change(s) in the coding region of MON1/YGL124C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 113 is now Serine rather than Cysteine. New 301 GCAAAGAGCAATGATGATACAACGAGAGCACTAAACAGTCCAAAAAAGGATTTCGGTCCT 360 |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| Old 301 GCAAAGAGCAATGATGATACAACGAGAGCACTAAACTGTCCAAAAAAGGATTTCGGTCCT 360 |
RSM23/YGL129C | A single T nucleotide was deleted within ORF RSM23/YGL129C, altering its coding sequence. The C-terminus and majority of the reading frame remain the same, but the N-terminus has changed and the annotated protein is now 38 amino acids shorter.
New: 1 ACAAGCCACGTGGT-ATACGTATCAGAATAATGCTA 35 |||||||||||||| ||||||||||||||||||||| Old: 85 ACAAGCCACGTGGTTATACGTATCAGAATAATGCTA 120 |
MDS3/YGL197W | Nucleotide change(s) in the coding region of MDS3/YGL197W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 262-264 are now QSE rather than HPK, and residue 403 is now Alanine rather than Arginine. New 781 TGGCAATCCG-AAACCATACCCAAACAACCGATGGAAATCACTACAAATGTCAATGGCAT 839 |||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||| Old 781 TGGC-ATCCGAAAACCATACCCAAACAACCGATGGAAATCACTACAAATGTCAATGGCAT 839 New 1200 ACGAGTCGCTACCGCCTGCCCTGACTGCGATATCAATAAACATCGATTCTGGAGGGTATT 1259 ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| Old 1200 ACGAGTCCGTACCGCCTGCCCTGACTGCGATATCAATAAACATCGATTCTGGAGGGTATT 1259 |
YGL214W | A single T nucleotide was inserted within ORF YGL214W very near its 5' end, altering its coding sequence. The reading frame and stop remain the same, but the start has been shifted downstream four nucleotides and the annotated protein is now one amino acid shorter.
New: 1 ATGATTGTAAGGTTACATGCAATATATCAAGATATTACTAGAGATTATTTACCGCCAGCT 60 ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| Old: 5 ATGAT-GTAAGGTTACATGCAATATATCAAGATATTACTAGAGATTATTTACCGCCAGCT 63 |
PEF1/YGR058W | Nucleotide change(s) in the coding region of PEF1/YGR058W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 324 is now Aspartic Acid rather than Tyrosine. New 961 GATTTTATCGATGCTACATTATATTTAGGTCGTTTCCTACCTCATTGA 1008 ||||||||| |||||||||||||||||||||||||||||||||||||| Old 961 GATTTTATCTATGCTACATTATATTTAGGTCGTTTCCTACCTCATTGA 1008 |
YGR067C | A single nucleotide substitution was made in the stop codon of ORF YGR067C, destroying it and increasing the length of the annotated protein by 10 amino acids.
New: 2415 TTATTTTATTTGGCTAAAAATTTCAATGTTTTTACTTTGTTTATTGTCAGTTGAAGAAGC 2356 |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| Old: 622376 TTATTTTATTTGGCTAAAAATTTCAATGTTTTAACTTTGTTTATTGTCAGTTGAAGAAGC 622435 |
ROM1/YGR070W | Nucleotide change(s) in the coding region of ROM1/YGR070W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 960 is now Valine rather than Alanine. New 2821 GACGGTTTCTGTAATGGTAAAAGAATCATTATGATTGCACATCATTTTTTGCACGCCGTA 2880 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | Old 2821 GACGGTTTCTGTAATGGTAAAAGAATCATTATGATTGCACATCATTTTTTGCACGCCGCA 2880 |
ENP2/YGR145W | Nucleotide change(s) in the coding region of ENP2/YGR145W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 678 is now Aspartic Acid rather than Glutamic Acid. New 1981 GGAAATTATAAATCCAGGCGTCATGATAATTCATCGGATGAAGAAGGTATTGACGAAAAT 2040 ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| Old 1981 GGAAATTATAAATCCAGGCGTCATGATAATTCATCGGATGAAGAAGGTATTGAAGAAAAT 2040 |
YGR153W | Nucleotide change(s) in the coding region of YGR153W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 158 is now Alanine rather than Aspartic Acid. New 421 GAACATGGAGAGGAGAGTGTAAAACCGTGTGGTTGTCATAAATCGAGAAAAGCAAAATGC 480 |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| Old 421 GAACATGGAGAGGAGAGTGTAAAACCGTGTGGTTGTCATAAATCGAGAAAAGACAAATGC 480 |
TOS2/YGR221C | Nucleotide change(s) in the coding region of TOS2/YGR221C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 69-91 are now EPSMQDFDPNFEGDLYYLPKMDS rather than NLLCRILTQILRAIYTIYRRWIT. New 181 GTAGTATATAGGAGATGCAAAAAAGAACCTTCTATGCAGGATTTTGACCCAAATTTTGAG 240 ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| Old 181 GTAGTATATAGGAGATGCAAAAA-GAACCTTCTATGCAGGATTTTGACCCAAATTTTGAG 239 New 241 GGCGATTTATACTATTTACCGAAGATGGATT-CTTCTATGAATTCTGCAAACTCAGACAG 299 ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| Old 240 GGCGATTTATACTATTTACCGAAGATGGATTACTTCTATGAATTCTGCAAACTCAGACAG 299 |
DIE2/YGR227W | Nucleotide change(s) in the coding region of DIE2/YGR227W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 266 is now Isoleucine rather than Lysine. New 781 GTTCTGCCCTATATGATAAATTTTGTTTTGTTCTTCATTTATCTGATTTGGAACAGATCC 840 |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| Old 781 GTTCTGCCCTATATGAAAAATTTTGTTTTGTTCTTCATTTATCTGATTTGGAACAGATCC 840 |
SLH1/YGR271W | Nucleotide change(s) in the coding region of SLH1/YGR271W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 51 is now Glutamine rather than Proline, residue 193 is now Lysine rather than Glutamic Acid, and residue 438 is now Serine rather than Proline. New 121 GACGAGCTaaaaaaaGTCCAAAAGGATGAACAAAATCAAAGAACTGAACTAACTGTTCTC 180 ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| Old 121 GACGAGCTAAAAAAAGTCCAAAAGGATGAACCAAATCAAAGAACTGAACTAACTGTTCTC 180 New 541 TTCCTGACACAGCAAGATATCAGGAATCAAGTTTTGAAAAGTGCAGAGGATGCCAAGAAT 600 |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| Old 541 TTCCTGACACAGCAAGATATCAGGAATCAAGTTTTGGAAAGTGCAGAGGATGCCAAGAAT 600 New 1261 GTCAAATTACTAATTATTGATGAAGTTCATTTACTGCACGAAGATAGAGGTTCGGTTATT 1320 ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| Old 1261 GTCAAATTACTAATTATTGATGAAGTTCATTTACTGCACGAAGATAGAGGTCCGGTTATT 1320 |
YHL037C | A single nucleotide was deleted within the ORF YHL037C, altering its coding sequence. The start and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 26 amino acids shorter.
New: 361 CATGCC-ATAACCCTTGCATGGTTAGCACACGCCCTCACGTGA 402 |||||| |||||||||||||||||||||||||||||||||||| Old: 361 CATGCCCATAACCCTTGCATGGTTAGCACACGCCCTCACGTGA 403 |
ARN2/YHL047C | A single nucleotide was inserted within the ORF ARN2/YHL047C near its 3' end, altering its coding sequence. The start and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 17 amino acids shorter.
New: 1801 GAAGATGATCCTATCAATGACTGGATCGCGAAACGTTTTGCAAAGGCCTTAGGCAGGTCATAA 1863 ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| Old: 1801 GAAGATGATCCTATCAATGACTGGATCGCGAAACGTTTTGCAAAGGCCTTAGG-AGGTCATAA 1862 |
YHR049C-A | A single nucleotide was deleted near the middle of ORF YHR049C-A, altering its coding sequence. The start remains the same, but the C-terminal half of the protein sequence has changed and the annotated protein is now five amino acids shorter.
New: 121 TTCGTAAGCCACGCTAAAGCACCCCGGGTGGATTTTTCGCGCCGGGCGGGGTT-AGCAGC 179 ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| Old: 121 TTCGTAAGCCACGCTAAAGCACCCCGGGTGGATTTTTCGCGCCGGGCGGGGTTTAGCAGC 180 |
YHR056W-A | Nucleotide change(s) in the coding region of YHR056W-A resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 116 is now Cysteine rather than Glycine. New 301 ACAGTCCGGCTTGTTATACTTGACGCAATTCCCACATATCGGTTTTGCCCTGTCGCACCC 360 ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| Old 301 ACAGTCCGGCTTGTTATACTTGACGCAATTCCCACATATCGGTTTGGCCCTGTCGCACCC 360 |
ERG7/YHR072W | Nucleotide change(s) in the coding region of ERG7/YHR072W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 530 is now Asparagine rather than Aspartic Acid. New 1561 ACCTTGAATCCTGCTGAAGTTTTTGGTAACATAATGGTAGAATACCCATACGTGGAATGT 1620 ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| Old 1561 ACCTTGAATCCTGCTGAAGTTTTTGGTGACATAATGGTAGAATACCCATACGTGGAATGT 1620 |
HXT4/YHR092C | One single nucleotide was inserted, and two single nucleotides deleted, within the ORF HXT4/YHR092C near its 3' end, altering its coding sequence. The start and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 16 amino acids longer.
New: 1731 CTACTTTTTTCCGAACATCTTCTTGTAAAATGG-TTGATC-ATCATGCATTAGATCATCA 1674 ||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||| Old: 287083 CTACTTTTTTCCGAACATCTTCTTGTAAAATGGGTTGATCCATCATGCATTAGATCATCA 287142 New: 1673 GCGTTGTAGTCAGTACCTCTCTTGTTTGGTGGAACCCAAGAAGGTGATTTCCATGGCAAA 1614 |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| Old: 287143 GCGTTGTAGTCAGTACCTCTCTTGTTTGGTGGAACC-AAGAAGGTGATTTCCATGGCAAA 287201 |
YHR095W | A single C nucleotide was inserted within ORF YHR095W, near its 3' end, altering its coding sequence. The start and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 20 amino acids longer.
New: 421 GCGCATGCGCAAGTAG 436 ||||||||| |||||| Old: 421 GCGCATGCG-AAGTAG 435 |
MTG2/YHR168W | A single G nucleotide was inserted very near the 3' end of ORF MTG2/YHR168W, altering its coding sequence. The start and most of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 19 amino acids longer.
New: 1441 TTTTCCAAAAGTCAGGAATGGGACTGTGTTCCGATAAGCGCCCTCAGAGAGGAAAACATA 1500 ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| Old: 441819 TTTTCCAAAAGTCAGGAATGGGACTGTGTTCCGATAAGCGCCCTCAGAGAG-AAAACATA 441877 New: 1501 GATGTGTTAAAGAAAAAGATGTTTAAGTGTGCTCGTCAGTCTGAATTTGACAAGTAG 1557 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Old: 441878 GATGTGTTAAAGAAAAAGATGTTTAAGTGTGCTCGTCAGTCTGAATTTGACAAGTAG 441934 |
RIX1/YHR197W | Nucleotide change(s) in the coding region of RIX1/YHR197W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 762 is now Glutamic Acid rather than Glycine. New 2281 GAAGAAGAATAA 2292 |||| ||||||| Old 2281 GAAGGAGAATAA 2292 |
YIL012W | A single G nucleotide was inserted within the ORF YIL012W near its 3' end, altering its coding sequence. The start and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 17 amino acids shorter.
New: 301 GAGGCGTACTTCGCCTTGCGGGAAAAAAAATTTCTTTTGTAA 342 |||||||||||||| ||||||||||||||||||||||||||| Old: 301 GAGGCGTACTTCGC-TTGCGGGAAAAAAAATTTCTTTTGTAA 341 |
CAB2/YIL083C | Nucleotide change(s) in the coding region of CAB2/YIL083C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 338 is now Serine rather than Isoleucine. New 961 TCCCCTGAAAACAGAAAGGGAGATTGGGTACGTTTGGATGAAAAACACCATAGCATTGAA 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| Old 961 TCCCCTGAAAACAGAAAGGGAGATTGGGTACGTTTGGATGAAAAACACCATATCATTGAA 1020 |
SIM1/YIL123W | Three nucleotides were inserted near the 5' end of ORF SIM1/YIL123W, altering its coding sequence. The start, stop, and majority of the reading frame remain the same, but the annotated protein sequence is now one amino acid longer and a small section of the sequence has changed.
New: 241 TCCGCAGCCGCTGCGGATAGCTCCGCTTCCATTGCTGTTTCATCTGCTGCCTTAGCCAAG 300 ||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||| Old: 241 TCCGCAGCCGCTG-GGATAGC--CGCTTCCATTGCTGTTTCATCTGCTGCCTTAGCCAAG 297 |
RPC17/YJL011C | Nucleotide change(s) in the coding region of RPC17/YJL011C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 159 is now Glycine rather than Alanine. New 421 TGTGATGCAAGATTTGACGAAAAAACAATTGAGGAAATGCTAGAGATCATCTCTGGCTAC 480 ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| Old 421 TGTGATGCAAGATTTGACGAAAAAACAATTGAGGAAATGCTAGAGATCATCTCTGCGTAC 480 |
YJL015C | A single nucleotide was inserted within the ORF YJL015C very near its 5' end, necessitating a change in annotation to a downstream start codon. The sequence change makes the longer version of the protein no longer possible in the reference sequence. The stop and reading frame remain the same, but the annotated protein is now 30 amino acids shorter.
New: 407390 ATCCTAATACTAAACTTTTTCGTTTAACGTGACGCATGGTGCGAAGAAAAAAAAATAGCA 407449 |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| Old: 407384 ATCCTAATACTAAACTTTTTCGTTTAACGTGACGCATGGTGCGAAGAAAAAAAA-TAGCA 407442 |
PBS2/YJL128C | Nucleotide change(s) in the coding region of PBS2/YJL128C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 222-223 are now GL rather than AV. New 661 CGAGGGCTCAAATTACCACCAGGAGGAATGTCATTAAAAATGCCCACTAAAACAGCTCAA 720 |||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||| Old 661 CGAGCGGTCAAATTACCACCAGGAGGAATGTCATTAAAAATGCCCACTAAAACAGCTCAA 720 |
URA2/YJL130C | Nucleotide change(s) in the coding region of URA2/YJL130C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 123 is now Alanine rather than Arginine. New 361 TATCTTGCTAAATCTTCCTTAGGTAAATGGTTACAAAATGAAGGGATCCCAGCTGTTTAT 420 |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| Old 361 TATCTTCGTAAATCTTCCTTAGGTAAATGGTTACAAAATGAAGGGATCCCAGCTGTTTAT 420 |
TPK1/YJL164C | Nucleotide change(s) in the coding region of TPK1/YJL164C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 79-86 are now SGKYSLQD rather than VGSIVYKN. New 181 ACTTATTACAATGAGGAGCAGTATAAACAGTTTATTGCCCAAGCGAGAGTTACAAGTGGG 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| Old 181 ACTTATTACAATGAGGAGCAGTATAAACAGTTTATTGCCCAAGCGAGAGTTACA-GTGGG 239 New 241 AAGTATAGTTTACAAGA-CTTTCAGATATTAAGGACACTGGGTACGGGTTCTTTTGGTAG 299 ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| Old 240 AAGTATAGTTTACAAGAACTTTCAGATATTAAGGACACTGGGTACGGGTTCTTTTGGTAG 299 |
SET2/YJL168C | Nucleotide change(s) in the coding region of SET2/YJL168C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 594 is now Alanine rather than Phenylalanine, residue 605 is now Alanine rather than Serine, and residue 716 is now Alanine rather than Glycine. New 1741 AATGAAAGAAAAAGCGTTTTGGAGGATATTATAGCGGAGGCCAACAAACAGAAGGAGTTA 1800 ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| Old 1741 AATGAAAGAAAAAGCGTTTTGGAGGATATTATAGCGGAGTTCAACAAACAGAAGGAGTTA 1800 New 1801 CAAAAGGAAGAGGCCAAAAAACTAGTGGAAGCAAAAGAGGCTAAGCGGTTGAAAAGAAAA 1860 |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| Old 1801 CAAAAGGAAGAGTCCAAAAAACTAGTGGAAGCAAAAGAGGCTAAGCGGTTGAAAAGAAAA 1860 New 2101 TACATGGATAAGATTATCCTCAAGAAGAAGCaaaaaaaGGCGTTGGCATTATCATCAGCA 2160 |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Old 2101 TACATGGATAAGATTATCCTCAAGAAGAAGCAAAAAAAGGCGTTGGGATTATCATCAGCA 2160 |
YJL169W | Nucleotide change(s) in the coding region of YJL169W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 62 is now Alanine rather than Proline. New 181 AATGCCAACGCCtttttttGCTTCTTCTTGAGGATAATCTTATCCATGTATGAATTTATG 240 ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| Old 181 AATCCCAACGCCTTTTTTTGCTTCTTCTTGAGGATAATCTTATCCATGTATGAATTTATG 240 |
YJL171C | Nucleotide change(s) in the coding region of YJL171C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 366 is now Lysine rather than Leucine, residue 371 is now Alanine rather than Arginine, and residue 374 is now Lysine rather than Asparagine. New 1081 CCTTCGACCACCTCGAAGTCGAATGGTGTTGCTTTAACGAAGATGCAAAACGGTGTATGG 1140 ||||||||||||||| ||||||||||||| ||||||||| |||||||||||||||||| Old 1081 CCTTCGACCACCTCGTTGTCGAATGGTGTTCGTTTAACGAACATGCAAAACGGTGTATGG 1140 |
PFD1/YJL179W | Nucleotide change(s) in the coding region of PFD1/YJL179W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 74 is now Aspartic Acid rather than Alanine. New 181 TTACAGGATAAATCCAAATACGTTAATGATTTATCACATGACGAAACTGTTCTTCTGGAT 240 |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| Old 181 TTACAGGATAAATCCAAATACGTTAATGATTTATCACATGCCGAAACTGTTCTTCTGGAT 240 |
MNN11/YJL183W | Nucleotide change(s) in the coding region of MNN11/YJL183W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 298 is now Aspartic Acid rather than Glycine. New 841 TACAATCATTTTGAATATAGTTCGGCAAAGATTATCATTCCACATGATGCGGATGGTAAT 900 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| Old 841 TACAATCATTTTGAATATAGTTCGGCAAAGATTATCATTCCACATGATGCGGGTGGTAAT 900 |
MNN5/YJL186W | Nucleotide change(s) in the coding region of MNN5/YJL186W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 395 is now Valine rather than Phenylalanine. New 1141 ATTTCTCAAGGCACTGCCGGTGAAGGTGACAAAGACACTTTCGTCGCTGCTGCCCATGCC 1200 |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| Old 1141 ATTTCTCAAGGCACTGCCGGTGAAGGTGACAAAGACACTTTCTTCGCTGCTGCCCATGCC 1200 |
BUD19/YJL188C | Nucleotide change(s) in the coding region of BUD19/YJL188C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 90 is now Cysteine rather than Tyrosine. New 241 GTTAGTAACAATGTTCAAACTCATCAATGTGATGCATTCACGGATCCAAGGCAATACCAC 300 |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| Old 241 GTTAGTAACAATGTTCAAACTCATCAATATGATGCATTCACGGATCCAAGGCAATACCAC 300 |
YJR098C | Three nucleotides were inserted near the middle of ORF YJR098C, altering its coding sequence. The start, stop, and majority of the reading frame remain the same, but the annotated protein sequence is now one amino acid longer and a small section of the sequence has changed.
New: 1201 TTTGGAGATGATGTGATGTGGAATAAAACTATTTTCACTAAAGAAACCAACTTTTTTATG 1260 ||||||||||||||||||||||||||| ||||||||||||| ||| |||||||||||||| Old: 1201 TTTGGAGATGATGTGATGTGGAATAAA-CTATTTTCACTAA-GAA-CCAACTTTTTTATG 1257 |
URA8/YJR103W | A single C nucleotide was inserted very near the 3' end of ORF URA8/YJR103W, altering its coding sequence. The start and most of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 14 amino acids longer.
New: 1621 ACATCGAAGGTGCTGGAACCATCAAGACCGTTTTGGGGGCTTGTGGCCGCAGCCTCCGGC 1680 ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| Old: 622363 ACATCGAAGGTGCTGGAACCATCAAGACCGTTTTGGGGGCTTGTGGCCGCAGC-TCCGGC 622421 New: 1681 ACACTTGGTGAAGTGATCAAGGACATAAATCTAAGCGAGGGAAATGAAAATGAATGA 1737 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Old: 622422 ACACTTGGTGAAGTGATCAAGGACATAAATCTAAGCGAGGGAAATGAAAATGAATGA 622478 |
ECM27/YJR106W | Nucleotide change(s) in the coding region of ECM27/YJR106W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 219 is now Asparagine rather than Aspartic Acid. New 601 AATCATTCTGCAGAAACCCCAGATGAAACTGCTGCGGATACGAGCCTCAGAGAAAACTCC 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| Old 601 AATCATTCTGCAGAAACCCCAGATGAAACTGCTGCGGATACGAGCCTCAGAGAAGACTCC 660 |
YJR107W | Nucleotide change(s) in the coding region of YJR107W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 14 is now Proline rather than Leucine, and residue 66 is now Glycine rather than Proline. New 1 ATGCCTGTTGTTCATTGTTCGTCCAACCTGCCCATCACTCCATATATCTATGAGCGTCTA 60 |||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||| Old 1 ATGCCTGTTGTTCATTGTTCGTCCAACCTGCCCATCACCCTATATATCTATGAGCGTCTA 60 New 181 ATTAACCCAACAGCGGGTCAAACAGTGGTTGAATTAGTTCTTAATGCaaaaaaaGGTGAA 240 ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| Old 181 ATTAACCCAACAGCGCCTCAAACAGTGGTTGAATTAGTTCTTAATGCAAAAAAAGGTGAA 240 |
YJR129C | Nucleotide change(s) in the coding region of YJR129C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 118 is now Lysine rather than Threonine. New 301 CCGATGATGAAAGACGTCGTGAGGTACAGGTTTGACGAGGACGTAAAGATCAAAATTGAG 360 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| Old 301 CCGATGATGAAAGACGTCGTGAGGTACAGGTTTGACGAGGACGTAAAGATCACAATTGAG 360 |
NMD5/YJR132W | Nucleotide change(s) in the coding region of NMD5/YJR132W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 258 is now Alanine rather than Serine. New 721 GCATGtttttttGTCAGCATCATTCAGCAGCCATTGCCTCAGGAAGTTTTGGCTATATCA 780 ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| Old 721 GCATGTTTTTTTGTCAGCATCATTCAGCAGCCATTGCCTCAGGAAGTTTTGTCTATATCA 780 |
YJR149W | Nucleotide change(s) in the coding region of YJR149W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 402 is now Aspartic Acid rather than Valine. New 1201 ATTGACGGAAAATAA 1215 |||| |||||||||| Old 1201 ATTGTCGGAAAATAA 1215 |
DAN1/YJR150C | Nucleotide change(s) in the coding region of DAN1/YJR150C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 115 is now Glutamic Acid rather than Glycine. New 301 TCTACTAGATTGATGGGTGCTATTTCCGAAGCACTTGCGAATGAAGGTATTGCTACTGCA 360 ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| Old 301 TCTACTAGATTGATGGGTGCTATTTCCGAAGCACTTGCGAATGGAGGTATTGCTACTGCA 360 |
YKL023W | Nucleotide change(s) in the coding region of YKL023W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 25-26 are now QQ rather than HE. New 61 TGCGTCACGGATCAGCAGGCCTACTCTAATTGGTTAAAGAATGATAATGATGAACGTACG 120 |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| Old 61 TGCGTCACGGATCACGAGGCCTACTCTAATTGGTTAAAGAATGATAATGATGAACGTACG 120 |
YET1/YKL065C | Nucleotide change(s) in the coding region of YET1/YKL065C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 16 is now Methionine rather than Valine. New 1 ATGAGTTTATACTTTACGACATTATTTTTATTGCTCACTGTTGAGATGGTAATGCTCTTC 60 ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| Old 1 ATGAGTTTATACTTTACGACATTATTTTTATTGCTCACTGTTGAGGTGGTAATGCTCTTC 60 |
HSL1/YKL101W | Nucleotide change(s) in the coding region of HSL1/YKL101W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 1482 is now Threonine rather than Serine. New 4441 TCTACGGTAATTACTGTaaaaaaaaGAAGCAAACATTCAAACACAAGTTCCAATAAAGCC 4500 || |||||||||||||||||||||||||||||||||||||||||||||||||||||||| Old 4441 TCATCGGTAATTACTGTAAAAAAAAGAAGCAAACATTCAAACACAAGTTCCAATAAAGCC 4500 |
MYO3/YKL129C | Three nucleotides were inserted within the ORF MYO3/YKL129C, and two nucleotides were substituted in the same region, altering the MYO3 coding sequence. The start, stop, and majority of the reading frame remain the same, but the annotated protein sequence is now one amino acid longer and a small section of the sequence has changed.
New: 781 TGTACTACTGCAGATACAATTGATGACGTAAAAGATTACGAAGGCACGTTAGAGGCTATG 840 ||||| |||||||| ||||||||| |||||| ||||||||||||||||||||||||||| Old: 781 TGTACATCTGCAGAT-CAATTGATG-CGTAAA-GATTACGAAGGCACGTTAGAGGCTATG 837 |
YKL133C | Nucleotide change(s) in the coding region of YKL133C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 252 is now Tyrosine rather than Isoleucine. New 721 GGTCTACCATTTATTGGTAAATCCAAACCTGACTACCAAATGCATTTAAACTCTAAAAGA 780 ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| Old 721 GGTCTACCATTTATTGGTAAATCCAAACCTGACATCCAAATGCATTTAAACTCTAAAAGA 780 |
OCT1/YKL134C | Six single nucleotides were inserted near the middle of ORF OCT1/YKL134C, and one nucleotide was inserted and another deleted near its 3' end, altering the OCT1 coding sequence. The start, stop, and majority of the reading frame remain the same, but the annotated protein is now one amino acid longer and two separate small sections of the protein sequence are now different.
New: 1021 GGTAAAATGGCAAAGAATCCGAAAGATGTTCAAGATTTTATTTTGACGTTAATGAACAAT 1080 |||||| |||||| || || ||| ||||| |||||||||||||||||||||||||||||| Old: 1021 GGTAAA-TGGCAA-GA-TC-GAA-GATGT-CAAGATTTTATTTTGACGTTAATGAACAAT 1074 New: 2041 CAGAGTAATTGGTGTGGAAGATTCGGCCATTTATTTGGATACGGGGCAACTTATTACAGC 2100 |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| Old: 2035 CAGAGTAATTGGTGTGGAAGATTCGGCCATTTATTTGGAT-CGGGGCAACTTATTACAGC 2093 New: 2101 TACTTATTT-GATAGGACGATAGCTTCTAAAATCTGGTACGCCCTTTTCGAGGATGATCC 2159 ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| Old: 2094 TACTTATTTTGATAGGACGATAGCTTCTAAAATCTGGTACGCCCTTTTCGAGGATGATCC 2153 |
APE2/YKL157W | A single G nucleotide was deleted within ORF APE2/YKL157W, near its 3' end, altering its coding sequence. The start and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 17 amino acids longer.
New: 3181 AGTGGG-TTAACAGAGACCGTGATGTCGTCAACAAGTATTTGAAGGAAAATGGTTACTAT 3239 |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| Old: 158176 AGTGGGGTTAACAGAGACCGTGATGTCGTCAACAAGTATTTGAAGGAAAATGGTTACTAT 158235 |
PTK1/YKL198C | Five nucleotide changes were made within the ORF PTK1/YKL198C, altering its coding sequence: one single insertion, two single deletions, and two substitutions. The start and majority of the reading frame remain the same, but a small section of the annotated protein sequence is now different, the C-terminus has changed, and the annotated protein is now 13 amino acids longer.
New: 721 AAGCGCTGCTC-AAAGGAGTTTATCATCGCAAAGCAGCTAAGTCATCATGTTCACATCAC 779 || |||||||| |||||||||||||||||||||||||||||||||||||||||||||||| Old: 721 AA-CGCTGCTCCAAAGGAGTTTATCATCGCAAAGCAGCTAAGTCATCATGTTCACATCAC 779 New: 840 CGTCATGGAGCTAGGTCTACGAGATTTGTTCGCGATGATACAAAAATCGGGCTGGCGCAG 899 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Old: 840 CGTCATGGAGCTAGGTCTACGAGATTTGTTCGCGATGATACAAAAATCGGGCTGGCGCCA 899 New: 1860 ACCTTCCGCACCTTCCGCTCGCGTCCGTGGCCACTCCCCGCACAGGGTAG-TGCATCACC 1918 |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| Old: 1860 ACCTTCCGCACCTTCCGCTCGCGTCCGTGGCCACTCCCCGCACAGGGTAGGTGCATCACC 1919 |
MCH2/YKL221W | Nucleotide change(s) in the coding region of MCH2/YKL221W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 342 is now Alanine rather than Arginine. New 1021 ATAGCTTTTGGATTATTGGTTGGTTCTATTATGGGAACAATTTGGCCAACAATTGCTTCA 1080 ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| Old 1021 ATACGTTTTGGATTATTGGTTGGTTCTATTATGGGAACAATTTGGCCAACAATTGCTTCA 1080 |
RSC4/YKR008W | Nucleotide change(s) in the coding region of RSC4/YKR008W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 390 is now Lysine rather than Isoleucine. New 1141 CCAAACAACTTCAAAAAGTTAATAGCCAAACCGGAAACAGTGCAATCCGAAGTCAAAAAT 1200 |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| Old 1141 CCAAACAACTTCAAAAAGTTAATAGCCATACCGGAAACAGTGCAATCCGAAGTCAAAAAT 1200 |
YKR012C | Nucleotide change(s) in the coding region of YKR012C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 98 is now Lysine rather than Glutamine, and residue 109 is now Lysine rather than Glutamine. New 241 ATCACAGCAATATGTAACACTCTGCGACAAGCATATATATATACAAAGATCAAAAGCATT 300 ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| Old 241 ATCACAGCAATATGTAACACTCTGCGACAAGCATATATATATACAAAGATCCAAAGCATT 300 New 301 GCCTTTGAACGACGTCTATGTTTCAAAAACATTACATATAGAGAAGTGCGTGAGATACAC 360 |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| Old 301 GCCTTTGAACGACGTCTATGTTTCCAAAACATTACATATAGAGAAGTGCGTGAGATACAC 360 |
SAP190/YKR028W | A single G nucleotide was inserted within the ORF SAP190/YKR028W near its 3' end, altering its coding sequence. The start and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 65 amino acids shorter.
New: 3001 TCAAGCGATGAAGAAGACTCCGAAGATGAAGATGAAGAGAATGATATGGGCAATGAGGAG 3060 |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| Old: 3001 TCAAGCGATGAAGAAGACTCCGAA-ATGAAGATGAAGAGAATGATATGGGCAATGAGGAG 3059 |
CAF4/YKR036C | Nucleotide change(s) in the coding region of CAF4/YKR036C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 94-95 are now QR rather than HG. New 241 TCTGCAACAACTTTCAGAATACTTGCTCATTTAGATGAGCAGCGATACCCGCTACCCAAC 300 ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| Old 241 TCTGCAACAACTTTCAGAATACTTGCTCATTTAGATGAGCACGGATACCCGCTACCCAAC 300 |
PXL1/YKR090W | Nucleotide change(s) in the coding region of PXL1/YKR090W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 688 is now Serine rather than Threonine. New 2041 GGTATCGACAATGCTACATCAAGCAATGATAAGAACAATACTCTCTCTAAAAGGAGAACG 2100 |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| Old 2041 GGTATCGACAATGCTACATCAACCAATGATAAGAACAATACTCTCTCTAAAAGGAGAACG 2100 |
YLL054C | A single nucleotide was inserted very near the 3' end of ORF YLL054C, altering its coding sequence. The start and most of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 74 amino acids longer.
New: 2281 GATAAGTCCTTTTCGTTCACATCAAAATTAA 2311 ||||||||||||||||||||| ||||||||| Old: 2281 GATAAGTCCTTTTCGTTCACA-CAAAATTAA 2310 |
SPH1/YLR313C | A GG dinucleotide was inserted within the ORF SPH1/YLR313C near its 3' end, altering its coding sequence. The start and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 131 amino acids shorter.
New: 1561 GTTGTTCTTCCTATGGCAGGCAGGGCATTTTGA 1593 |||||||||||||||||| ||||||||||||| Old: 1561 GTTGTTCTTCCTATGGCA--CAGGGCATTTTGA 1591 |
CDC3/YLR314C | Nucleotide change(s) in the coding region of CDC3/YLR314C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 431 is now Glutamine rather than Leucine. New 1261 TTCAAAGAGTTCGATCCAATATCTAAACAACAAGAAGAAAAAACTTTACATGAGGCAAAA 1320 ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| Old 1261 TTCAAAGAGTTCGATCCAATATCTAAACAACTAGAAGAAAAAACTTTACATGAGGCAAAA 1320 |
EST2/YLR318W | Nucleotide change(s) in the coding region of EST2/YLR318W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 162 is now Alanine rather than Valine. New 481 TGGGCTCAACGATCATCCTCATCATCCGCAACTGCTGCGCAAATCAAACAACTTACAGAA 540 |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| Old 481 TGGGTCCAACGATCATCCTCATCATCCGCAACTGCTGCGCAAATCAAACAACTTACAGAA 540 |
YLR402W | A single G nucleotide was inserted within the ORF YLR402W near its 5' end, necessitating a change in annotation to a downstream start codon. The sequence change makes the longer version of the protein no longer possible in the reference sequence. The stop and reading frame remain the same, but the annotated protein is now 108 amino acids shorter, less than half its original size.
New: 924657 TTAAGTCTCTTCATCCCGTGTACTATTACCCGACAGGTTTCTGCGGCATGTTCTGTGGAA 924716 ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| Old: 924657 TTAAGTCTCTTCATCCCGTGTACTATTACCCGACA-GTTTCTGCGGCATGTTCTGTGGAA 924715 |
YLR407W | A single G nucleotide was inserted within the ORF YLR407W near its 3' end, altering its coding sequence. The start and vast majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now one amino acid shorter.
New: 661 GCTAATGCTGCCAAGGGCATGCCATGA 687 |||||||||||||||| |||||||||| Old: 661 GCTAATGCTGCCAAGG-CATGCCATGA 686 |
YMR262W | Nucleotide change(s) in the coding region of YMR262W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 167 is now Cysteine rather than Tryptophan. New 481 ACAGTATTCAGGCGATTTTGCCGACTGGCAAGGCACACAAGCAAGCCCATCTCTATACAC 540 |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| Old 481 ACAGTATTCAGGCGATTTTGGCGACTGGCAAGGCACACAAGCAAGCCCATCTCTATACAC 540 |
YMR290W-A | Nucleotide change(s) in the coding region of YMR290W-A resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 105-107 are now KKK rather than RKR. New 301 aaaaaaaaaaaaaagaaaaagcaaataaaaaaTTTTCAATTCGGGTAA 348 ||||||||||||| ||||| |||||||||||||||||||||||||||| Old 301 AAAAAAAAAAAAAGGAAAAGGCAAATAAAAAATTTTCAATTCGGGTAA 348 |
DYN3/YMR299C | Nucleotide change(s) in the coding region of DYN3/YMR299C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 223 is now Lysine rather than Threonine. New 661 ATGGTCAAACGCAGTGAGATATTAATACCGAAGGGGTGCGATTCTATTGGATTGATAAAA 720 ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| Old 661 ATGGTCACACGCAGTGAGATATTAATACCGAAGGGGTGCGATTCTATTGGATTGATAAAA 720 |
YMR317W | Nucleotide change(s) in the coding region of YMR317W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 271-279 are now VISSEASWA rather than SVSSEASSS. New 781 AGTTCAGAAGCTCCATCGGCAACGTCTAGCGTAATTAGTTCAGAAGCTTCATGGGCAACG 840 |||||||||||||||||||||||||||||| | | ||||| |||||||||| | |||| Old 781 AGTTCAGAAGCTCCATCGGCAACGTCTAGCTCAGTGAGTTCGGAAGCTTCATCGTCAACA 840 New 841 TCTAGCTCAGTGAGCTCGGAAGCTCCATTGGCAACGTCTAGCGTAGTGAGTTCAGAAGCT 900 |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| Old 841 TCTAGCTCAGTGAGTTCGGAAGCTCCATTGGCAACGTCTAGCGTAGTGAGTTCAGAAGCT 900 |
YNL008C | A single C nucleotide was deleted within ORF YNL008C, altering its coding sequence. The C-terminus and majority of the reading frame remain the same, but the N-terminus has changed and the annotated protein is now 7 amino acids longer.
New: 1 TGCTCCATAACA-GAGATGTATTTAGCTTTTT 31 |||||||||||| ||||||||||||||||||| Old: 13 TGCTCCATAACACGAGATGTATTTAGCTTTTT 44 |
APC1/YNL172W | Nucleotide change(s) in the coding region of APC1/YNL172W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 1547 is now Methionine rather than Isoleucine. New 4621 TTGAAGCATTTCTGGAGCATGGCTGTAGAGCCTCGTTGCCTTGTTATAAAGGACATTTCC 4680 |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| Old 4621 TTGAAGCATTTCTGGAGCATTGCTGTAGAGCCTCGTTGCCTTGTTATAAAGGACATTTCC 4680 |
NOP13/YNL175C | Nucleotide change(s) in the coding region of NOP13/YNL175C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 296 is now Alanine rather than Glutamic Acid. New 841 GGATTCGCATTTATCGACTTCAAGAATGAAGAAGGATCTACTAATGCATTAAAGGATAAA 900 |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Old 841 GGATTCGCATTTATCGACTTCAAGAATGAAGAAGGATCTACTAATGAATTAAAGGATAAA 900 |
YNL176C | Nucleotide change(s) in the coding region of YNL176C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 251 is now Phenylalanine rather than Cysteine. New 721 CCTTCTACGATATCAAATAAAGATACCACATTCCCAAGTTCCAGTCGGAATACTTCCACA 780 ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| Old 721 CCTTCTACGATATCAAATAAAGATACCACATGCCCAAGTTCCAGTCGGAATACTTCCACA 780 |
MRPL22/YNL177C | Nucleotide change(s) in the coding region of MRPL22/YNL177C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 151 is now Leucine rather than Phenylalanine. New 421 CCAAATTCTAGCGAACGTTACAAGCTAAAGTTAACAAAAAGAGAAATTGAAGTACTAGAA 480 |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| Old 421 CCAAATTCTAGCGAACGTTACAAGCTAAAGTTCACAAAAAGAGAAATTGAAGTACTAGAA 480 |
YNL181W | Nucleotide change(s) in the coding region of YNL181W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 262 is now Alanine rather than Proline. New 781 GGCGCTGAAAGAACAGGAAAAAATGTTACCATTACTATGGTTCAACCTGGAACTATGAGA 840 ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| Old 781 GGCCCTGAAAGAACAGGAAAAAATGTTACCATTACTATGGTTCAACCTGGAACTATGAGA 840 |
UBP10/YNL186W | Nucleotide change(s) in the coding region of UBP10/YNL186W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 310 is now Glutamic Acid rather than Aspartic Acid. New 901 ggagaggaggaggaagaagaggaagaagagCTGAAACATAAATCTAGGTCAATCACCCCT 960 ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| Old 901 GGAGAGGAGGAGGAAGAAGAGGAAGAAGATCTGAAACATAAATCTAGGTCAATCACCCCT 960 |
CHS1/YNL192W | Nucleotide change(s) in the coding region of CHS1/YNL192W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 815 is now Valine rather than Phenylalanine. New 2401 AATACATTGATTTCATGGTTTTCATTGAGTTCATTTTTCCTAGTCTTTAGAATTCTCACT 2460 |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| Old 2401 AATACATTGATTTCATGGTTTTCATTGAGTTCATTTTTCCTATTCTTTAGAATTCTCACT 2460 |
YNL193W | Nucleotide change(s) in the coding region of YNL193W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 122 is now Leucine rather than Valine. New 361 TCTCTGCCACAGATTATCCAACGGTTTGAAATTGTTTATGAGACTTTCCCAGAACAGAGA 420 ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| Old 361 TCTGTGCCACAGATTATCCAACGGTTTGAAATTGTTTATGAGACTTTCCCAGAACAGAGA 420 |
SLA2/YNL243W | Nucleotide change(s) in the coding region of SLA2/YNL243W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 344 is now Alanine rather than Arginine. New 1021 ACTGGTGCAGCTAACGCCATTTTTCCACAGGCGACGGCACAAATGCAGCCGGACTTCTGG 1080 ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| Old 1021 ACTGGTGCACGTAACGCCATTTTTCCACAGGCGACGGCACAAATGCAGCCGGACTTCTGG 1080 |
BNI1/YNL271C | Nucleotide change(s) in the coding region of BNI1/YNL271C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 938 is now Alanine rather than Threonine. New 2761 AAGCCTCAAGAGGCGGACGTAAATAAACTAAATGACCTAAGGCGGGCTTTGGCTGAAATC 2820 ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| Old 2761 AAGCCTCAAGAGGCGGACGTAAATAAACTAAATGACCTAAGGCGGGCTTTGACTGAAATC 2820 |
EGT2/YNL327W | Nucleotide change(s) in the coding region of EGT2/YNL327W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 577 is now Threonine rather than Alanine. New 1681 AGTTCTACTACGTCCAGTTTATCATCCGGCCCATTTGTTTCAAACACAACGGTTGCCTCT 1740 |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Old 1681 AGTTCTACTACGTCCAGTTTATCATCCGGCCCATTTGTTTCAAACACAGCGGTTGCCTCT 1740 |
ARG1/YOL058W | Nucleotide change(s) in the coding region of ARG1/YOL058W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 329-332 are now SYFT rather than FLLH. New 961 TACTCCAGATTGATATATAACGG-TTCCTACTTCACCCCAGAGTGTGAGTACATCAGATC 1019 ||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||| Old 961 TACTCCAGATTGATATATAACGGTTTCCTACTTCA-CCCAGAGTGTGAGTACATCAGATC 1019 |
YOL075C | Nucleotide change(s) in the coding region of YOL075C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 1164 is now Alanine rather than Arginine. New 3481 TGTGGCGAAGCTCTTGGTATAATGACAAATACATTTTTCGAAAGGCCAGGCTTCGTCGTT 3540 ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| Old 3481 TGTGGCGAACGTCTTGGTATAATGACAAATACATTTTTCGAAAGGCCAGGCTTCGTCGTT 3540 |
BRX1/YOL077C | Nucleotide change(s) in the coding region of BRX1/YOL077C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 161 is now Glycine rather than Cysteine. New 481 GGTGTACCACCAAATGCTAGAAAATCTAAGCCATTTATTGATCACGTCATGTCCTTCAGT 540 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Old 481 TGTGTACCACCAAATGCTAGAAAATCTAAGCCATTTATTGATCACGTCATGTCCTTCAGT 540 |
RTC1/YOL138C | Nucleotide change(s) in the coding region of RTC1/YOL138C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 393 is now Cysteine rather than Serine, and residue 548 is now Aspartic Acid rather than Glycine. New 1141 CAAGAATACATTGCTACAGGTGGTAGAGACGGTAAATGCTGCCTCTGGTTTGTTGGCGAC 1200 ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| Old 1141 CAAGAATACATTGCTACAGGTGGTAGAGACGGTAAATCCTGCCTCTGGTTTGTTGGCGAC 1200 New 1621 GGTAACGGTTTACTTTCAGTTGACCAAGAGATAGGCTCATATGAGGTGGTAGAACCGGAG 1680 |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| Old 1621 GGTAACGGTTTACTTTCAGTTGGCCAAGAGATAGGCTCATATGAGGTGGTAGAACCGGAG 1680 |
PPM2/YOL141W | Nucleotide change(s) in the coding region of PPM2/YOL141W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 417 is now Leucine rather than Methionine. New 1201 TTTTACATGGGAGGTAGTAACCCATACAGAGTAAACGAAATATTACAGTTGAGTATACAC 1260 |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Old 1201 TTTTACATGGGAGGTAGTAACCCATACAGAGTAAACGAAATATTACAGATGAGTATACAC 1260 |
RRP40/YOL142W | Nucleotide change(s) in the coding region of RRP40/YOL142W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 160 is now Leucine rather than Phenylalanine. New 421 ACAGGACGCGATGCTGGTTTCGGGATATTGGAAGATGGTATGATCATTGACGTGAATTTG 480 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Old 421 ACAGGACGCGATGCTGGTTTCGGGATATTGGAAGATGGTATGATCATTGACGTGAATTTC 480 |
CTR9/YOL145C | Nucleotide change(s) in the coding region of CTR9/YOL145C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 197 is now Lysine rather than Glutamic Acid, residue 674 is now Glutamic Acid rather than Glycine, residue 786 is now Arginine rather than Threonine, residue 903 is now Glutamic Acid rather than Lysine, residue 907 is now Serine rather than Arginine, residues 956-959 are now LIQE rather than IFQV, and residue 987 is now Lysine rather than Glutamine. |
ORT1/YOR130C | Nucleotide change(s) in the coding region of ORT1/YOR130C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 105 is now Serine rather than Phenylalanine. New 301 CATACAAACGTTTCCCCGTTGGGGCAAATCCTGATCTCTGGTGGAGTAGCGGGTTCATGT 360 ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| Old 301 CATACAAACGTTTTCCCGTTGGGGCAAATCCTGATCTCTGGTGGAGTAGCGGGTTCATGT 360 |
SFL1/YOR140W | Nucleotide change(s) in the coding region of SFL1/YOR140W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 446-462 are now FVQYQPQSQQHVTYAKQ rather than LYNTNRSRNQHVTYASE. New 1321 CCGCCCTCGCAACTTTTTGTACAATACCAACCGCAGTCGCAA-CAACATGTGACTTATGC 1379 ||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||| Old 1321 CCGCCCTCGCAAC-TTTTGTACAATACCAACCGCAGTCGCAACCAACATGTGACTTATGC 1379 New 1380 GAAGCAACCGGCACATGTACCAAACTTTATCAATCAGCCGATACCCATCCAACAACTACC 1439 || ||||||||||||||||||||||||||||||||||||||||||||||||||||||| Old 1380 GAGCGAACCGGCACATGTACCAAACTTTATCAATCAGCCGATACCCATCCAACAACTACC 1439 |
SMP3/YOR149C | Nucleotide change(s) in the coding region of SMP3/YOR149C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 122-123 are now IK rather than MQ. New 361 TTCATCaaaaaaaGTCTACTTTTAACTTCTTACGTAACCTGGACGTACCAAACACACACG 420 ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| Old 361 TTCATGCAAAAAAGTCTACTTTTAACTTCTTACGTAACCTGGACGTACCAAACACACACG 420 |
TIM18/YOR297C | Nucleotide change(s) in the coding region of TIM18/YOR297C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 137 is now Glutamic Acid rather than Glycine. New 361 TATTTACAGTATGGCTTCACAAGTTGTATTATTGACTATATACCGAAGGAAAAGTATCCA 420 ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| Old 361 TATTTACAGTATGGCTTCACAAGTTGTATTATTGACTATATACCGAAGGGAAAGTATCCA 420 |
MCH5/YOR306C | Nucleotide change(s) in the coding region of MCH5/YOR306C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 495 is now Cysteine rather than Serine. New 1441 TCTATCAAGACAACGGCCGATTACCAACACTATATTATTTTTTGCGGTTTGGCAACTTTT 1500 ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| Old 1441 TCTATCAAGACAACGGCCGATTACCAACACTATATTATTTTTTCCGGTTTGGCAACTTTT 1500 |
MMT2/YPL224C | Two nucleotide changes were made within the ORF MMT2/YPL224C, altering its coding sequence: one single nucleotide substitution near the 5' end, and one single nucleotide insertion near the 3' end. The start and majority of the reading frame remain the same, but the C-terminus has changed, and the annotated protein is now 35 amino acids longer.
New: 1 ATGCTACGGATAAGTATTGACTCTATCAAGCAATTCGGTTCCTTTGTGCCAGGTTATAAC 60 |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Old: 1 ATGCTACGGATAAGTATTGACTCTATCAAGCAATTCGGTTCCTTTGTGACAGGTTATAAC 60 New: 1321 GGGAAGGTGGACGTCGAGTTTGTTGATGTAA 1351 || |||||||||||||||||||||||||||| Old: 1321 GG-AAGGTGGACGTCGAGTTTGTTGATGTAA 1350 |
GLN1/YPR035W | Nucleotide change(s) in the coding region of GLN1/YPR035W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 251 is now Threonine rather than Alanine, and residue 264 is now Methionine rather than Threonine. New 721 AAGGGTGACTGGAACGGTGCCGGTTGTCACACTAACGTTTCCACCAAGGAAATGAGACAA 780 |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| Old 721 AAGGGTGACTGGAACGGTGCCGGTTGTCACGCTAACGTTTCCACCAAGGAAATGAGACAA 780 New 781 CCAGGTGGTATGAAATACATCGAACAAGCCATCGAGAAGTTATCCAAGAGACACGCTGAA 840 |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| Old 781 CCAGGTGGTACGAAATACATCGAACAAGCCATCGAGAAGTTATCCAAGAGACACGCTGAA 840 |
YPR097W | Nucleotide change(s) in the coding region of YPR097W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 848 is now Serine rather than Glycine. New 2521 AAAAATTTTGAGAAGTTCATGAGTGATTTGATCAGGCTTGTTGATGATGTTATCAATGGT 2580 ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| Old 2521 AAAAATTTTGAGAAGTTCATGGGTGATTTGATCAGGCTTGTTGATGATGTTATCAATGGT 2580 |
THI22/YPR121W | Nucleotide change(s) in the coding region of THI22/YPR121W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 95 is now Glutamine rather than Histidine. New 241 ACTACTTTGACTGCTCAAACTCCAGTGAAGGTGTACGGCGCTCAAAATATACCAAAGAAA 300 |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Old 241 ACTACTTTGACTGCTCAAACTCCAGTGAAGGTGTACGGCGCTCATAATATACCAAAGAAA 300 |